ID: 1075823175

View in Genome Browser
Species Human (GRCh38)
Location 10:125331349-125331371
Sequence CCAGATGGCCACTTTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075823175_1075823184 27 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823184 10:125331399-125331421 TGCCCCAGAAATGGCTTTAGCGG No data
1075823175_1075823180 1 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823180 10:125331373-125331395 CACAGGTATCAGCAGTGTGGAGG No data
1075823175_1075823185 28 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823185 10:125331400-125331422 GCCCCAGAAATGGCTTTAGCGGG No data
1075823175_1075823179 -2 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823179 10:125331370-125331392 GGACACAGGTATCAGCAGTGTGG No data
1075823175_1075823189 30 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823189 10:125331402-125331424 CCCAGAAATGGCTTTAGCGGGGG No data
1075823175_1075823187 29 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823187 10:125331401-125331423 CCCCAGAAATGGCTTTAGCGGGG No data
1075823175_1075823183 18 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823183 10:125331390-125331412 TGGAGGGGCTGCCCCAGAAATGG No data
1075823175_1075823182 3 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823182 10:125331375-125331397 CAGGTATCAGCAGTGTGGAGGGG No data
1075823175_1075823181 2 Left 1075823175 10:125331349-125331371 CCAAGGTCAAAGTGGCCATCTGG No data
Right 1075823181 10:125331374-125331396 ACAGGTATCAGCAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075823175 Original CRISPR CCAGATGGCCACTTTGACCT TGG (reversed) Intergenic
No off target data available for this crispr