ID: 1075823258

View in Genome Browser
Species Human (GRCh38)
Location 10:125331932-125331954
Sequence TTTTCCACGTGTACATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075823257_1075823258 7 Left 1075823257 10:125331902-125331924 CCTAAACAGACTTCTTTTCAATT No data
Right 1075823258 10:125331932-125331954 TTTTCCACGTGTACATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075823258 Original CRISPR TTTTCCACGTGTACATAAGA AGG Intergenic
No off target data available for this crispr