ID: 1075823741

View in Genome Browser
Species Human (GRCh38)
Location 10:125335974-125335996
Sequence TGTCATCTGCTGTATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075823735_1075823741 8 Left 1075823735 10:125335943-125335965 CCAGACCAAGGACCATTTTTGTG No data
Right 1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG No data
1075823738_1075823741 3 Left 1075823738 10:125335948-125335970 CCAAGGACCATTTTTGTGGTGGA No data
Right 1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG No data
1075823739_1075823741 -4 Left 1075823739 10:125335955-125335977 CCATTTTTGTGGTGGATAGTGTC No data
Right 1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075823741 Original CRISPR TGTCATCTGCTGTATGTGGA AGG Intergenic
No off target data available for this crispr