ID: 1075825991

View in Genome Browser
Species Human (GRCh38)
Location 10:125357392-125357414
Sequence GAAAATGGACTAATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075825991_1075825995 9 Left 1075825991 10:125357392-125357414 CCCAGCTGTATTAGTCCATTTTC No data
Right 1075825995 10:125357424-125357446 ATGAAGACATACCCAAGACTGGG 0: 84
1: 2731
2: 5008
3: 8070
4: 8996
1075825991_1075825998 29 Left 1075825991 10:125357392-125357414 CCCAGCTGTATTAGTCCATTTTC No data
Right 1075825998 10:125357444-125357466 GGGCAATTTGCAAAAGAAAGAGG 0: 57
1: 1658
2: 1789
3: 1826
4: 5942
1075825991_1075825994 8 Left 1075825991 10:125357392-125357414 CCCAGCTGTATTAGTCCATTTTC No data
Right 1075825994 10:125357423-125357445 GATGAAGACATACCCAAGACTGG 0: 51
1: 1464
2: 3905
3: 6335
4: 7497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075825991 Original CRISPR GAAAATGGACTAATACAGCT GGG (reversed) Intergenic
No off target data available for this crispr