ID: 1075833202

View in Genome Browser
Species Human (GRCh38)
Location 10:125428548-125428570
Sequence GACTCAGATGTCCCACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075833193_1075833202 28 Left 1075833193 10:125428497-125428519 CCTGGGAAGGCTGGTACTGGGAG No data
Right 1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG No data
1075833192_1075833202 29 Left 1075833192 10:125428496-125428518 CCCTGGGAAGGCTGGTACTGGGA No data
Right 1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075833202 Original CRISPR GACTCAGATGTCCCACAGTG GGG Intergenic
No off target data available for this crispr