ID: 1075838547

View in Genome Browser
Species Human (GRCh38)
Location 10:125477264-125477286
Sequence GCACCCTGCCTGGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075838539_1075838547 21 Left 1075838539 10:125477220-125477242 CCCTTGGTGCACACAGGGTGGAC No data
Right 1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG No data
1075838540_1075838547 20 Left 1075838540 10:125477221-125477243 CCTTGGTGCACACAGGGTGGACG No data
Right 1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075838547 Original CRISPR GCACCCTGCCTGGCTCCAGC AGG Intergenic
No off target data available for this crispr