ID: 1075839984

View in Genome Browser
Species Human (GRCh38)
Location 10:125493554-125493576
Sequence CTCAGTTAGCAGCTCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075839980_1075839984 4 Left 1075839980 10:125493527-125493549 CCTTTGCAGATTCCAGCATATTG No data
Right 1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG No data
1075839979_1075839984 12 Left 1075839979 10:125493519-125493541 CCATGTTTCCTTTGCAGATTCCA No data
Right 1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG No data
1075839978_1075839984 23 Left 1075839978 10:125493508-125493530 CCTAGAATCGGCCATGTTTCCTT No data
Right 1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG No data
1075839983_1075839984 -8 Left 1075839983 10:125493539-125493561 CCAGCATATTGAGGGCTCAGTTA No data
Right 1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075839984 Original CRISPR CTCAGTTAGCAGCTCTGCAG AGG Intergenic
No off target data available for this crispr