ID: 1075841300

View in Genome Browser
Species Human (GRCh38)
Location 10:125506467-125506489
Sequence TAGGTATACGTGTGCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51980
Summary {0: 293, 1: 3744, 2: 8244, 3: 27622, 4: 12077}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075841300_1075841304 13 Left 1075841300 10:125506467-125506489 CCACCATGGCACACGTATACCTA 0: 293
1: 3744
2: 8244
3: 27622
4: 12077
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075841300 Original CRISPR TAGGTATACGTGTGCCATGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr