ID: 1075841301

View in Genome Browser
Species Human (GRCh38)
Location 10:125506470-125506492
Sequence ACGTAGGTATACGTGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17342
Summary {0: 16, 1: 434, 2: 4101, 3: 6733, 4: 6058}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075841301_1075841304 10 Left 1075841301 10:125506470-125506492 CCATGGCACACGTATACCTACGT 0: 16
1: 434
2: 4101
3: 6733
4: 6058
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075841301 Original CRISPR ACGTAGGTATACGTGTGCCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr