ID: 1075841302

View in Genome Browser
Species Human (GRCh38)
Location 10:125506486-125506508
Sequence AACGTGAAGGTTTGTTACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075841302_1075841304 -6 Left 1075841302 10:125506486-125506508 CCTACGTAACAAACCTTCACGTT No data
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075841302 Original CRISPR AACGTGAAGGTTTGTTACGT AGG (reversed) Intergenic
No off target data available for this crispr