ID: 1075841304

View in Genome Browser
Species Human (GRCh38)
Location 10:125506503-125506525
Sequence CACGTTCCGCACATGTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075841300_1075841304 13 Left 1075841300 10:125506467-125506489 CCACCATGGCACACGTATACCTA 0: 293
1: 3744
2: 8244
3: 27622
4: 12077
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data
1075841301_1075841304 10 Left 1075841301 10:125506470-125506492 CCATGGCACACGTATACCTACGT 0: 16
1: 434
2: 4101
3: 6733
4: 6058
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data
1075841302_1075841304 -6 Left 1075841302 10:125506486-125506508 CCTACGTAACAAACCTTCACGTT No data
Right 1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075841304 Original CRISPR CACGTTCCGCACATGTATAT TGG Intergenic
No off target data available for this crispr