ID: 1075841755

View in Genome Browser
Species Human (GRCh38)
Location 10:125510596-125510618
Sequence CAGTCAAAGAGGAAGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075841755_1075841759 -1 Left 1075841755 10:125510596-125510618 CCTTTTACCTTCCTCTTTGACTG No data
Right 1075841759 10:125510618-125510640 GAGAGGCCTCCCCAGCCATGTGG 0: 18
1: 2666
2: 6281
3: 7078
4: 5310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075841755 Original CRISPR CAGTCAAAGAGGAAGGTAAA AGG (reversed) Intergenic
No off target data available for this crispr