ID: 1075841755 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:125510596-125510618 |
Sequence | CAGTCAAAGAGGAAGGTAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1075841755_1075841759 | -1 | Left | 1075841755 | 10:125510596-125510618 | CCTTTTACCTTCCTCTTTGACTG | No data | ||
Right | 1075841759 | 10:125510618-125510640 | GAGAGGCCTCCCCAGCCATGTGG | 0: 18 1: 2666 2: 6281 3: 7078 4: 5310 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1075841755 | Original CRISPR | CAGTCAAAGAGGAAGGTAAA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |