ID: 1075842134

View in Genome Browser
Species Human (GRCh38)
Location 10:125513907-125513929
Sequence AGGGACTAAGTGGCTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075842124_1075842134 20 Left 1075842124 10:125513864-125513886 CCCGCAAGCCCAGCAGCCGGTGA No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842127_1075842134 11 Left 1075842127 10:125513873-125513895 CCAGCAGCCGGTGACACCTTGAT No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842131_1075842134 -5 Left 1075842131 10:125513889-125513911 CCTTGATGACTCTGTACCAGGGA No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842123_1075842134 21 Left 1075842123 10:125513863-125513885 CCCCGCAAGCCCAGCAGCCGGTG No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842126_1075842134 12 Left 1075842126 10:125513872-125513894 CCCAGCAGCCGGTGACACCTTGA No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842120_1075842134 27 Left 1075842120 10:125513857-125513879 CCTGACCCCCGCAAGCCCAGCAG No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842128_1075842134 4 Left 1075842128 10:125513880-125513902 CCGGTGACACCTTGATGACTCTG No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842122_1075842134 22 Left 1075842122 10:125513862-125513884 CCCCCGCAAGCCCAGCAGCCGGT No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data
1075842125_1075842134 19 Left 1075842125 10:125513865-125513887 CCGCAAGCCCAGCAGCCGGTGAC No data
Right 1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075842134 Original CRISPR AGGGACTAAGTGGCTAGAGA AGG Intergenic
No off target data available for this crispr