ID: 1075842321

View in Genome Browser
Species Human (GRCh38)
Location 10:125515647-125515669
Sequence CCATCCTGCTTTGTCTCTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075842316_1075842321 15 Left 1075842316 10:125515609-125515631 CCAGAGAGATCTGAGGGTGGGAC No data
Right 1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG No data
1075842319_1075842321 -9 Left 1075842319 10:125515633-125515655 CCAGACAGGAACGGCCATCCTGC No data
Right 1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG No data
1075842315_1075842321 16 Left 1075842315 10:125515608-125515630 CCCAGAGAGATCTGAGGGTGGGA No data
Right 1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075842321 Original CRISPR CCATCCTGCTTTGTCTCTAG CGG Intergenic
No off target data available for this crispr