ID: 1075843426

View in Genome Browser
Species Human (GRCh38)
Location 10:125524502-125524524
Sequence ATTTTCTTCTAGGAGTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075843419_1075843426 21 Left 1075843419 10:125524458-125524480 CCAAAAATCATTGCCAAGATCCA No data
Right 1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498
1075843418_1075843426 22 Left 1075843418 10:125524457-125524479 CCCAAAAATCATTGCCAAGATCC No data
Right 1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498
1075843421_1075843426 8 Left 1075843421 10:125524471-125524493 CCAAGATCCATGTCAAGGAGCTT No data
Right 1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498
1075843422_1075843426 1 Left 1075843422 10:125524478-125524500 CCATGTCAAGGAGCTTTACCCTA No data
Right 1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075843426 Original CRISPR ATTTTCTTCTAGGAGTTTTA AGG Intergenic
Too many off-targets to display for this crispr