ID: 1075844047

View in Genome Browser
Species Human (GRCh38)
Location 10:125530682-125530704
Sequence AACTCTGCCCTGCTGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075844047_1075844051 9 Left 1075844047 10:125530682-125530704 CCTGTCAGCAGCAGGGCAGAGTT No data
Right 1075844051 10:125530714-125530736 GGAAGTCCAGCCCTAGATCTAGG No data
1075844047_1075844052 10 Left 1075844047 10:125530682-125530704 CCTGTCAGCAGCAGGGCAGAGTT No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075844047 Original CRISPR AACTCTGCCCTGCTGCTGAC AGG (reversed) Intergenic