ID: 1075844047 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:125530682-125530704 |
| Sequence | AACTCTGCCCTGCTGCTGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075844047_1075844052 | 10 | Left | 1075844047 | 10:125530682-125530704 | CCTGTCAGCAGCAGGGCAGAGTT | No data | ||
| Right | 1075844052 | 10:125530715-125530737 | GAAGTCCAGCCCTAGATCTAGGG | No data | ||||
| 1075844047_1075844051 | 9 | Left | 1075844047 | 10:125530682-125530704 | CCTGTCAGCAGCAGGGCAGAGTT | No data | ||
| Right | 1075844051 | 10:125530714-125530736 | GGAAGTCCAGCCCTAGATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075844047 | Original CRISPR | AACTCTGCCCTGCTGCTGAC AGG (reversed) | Intergenic | ||