ID: 1075844052

View in Genome Browser
Species Human (GRCh38)
Location 10:125530715-125530737
Sequence GAAGTCCAGCCCTAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075844044_1075844052 17 Left 1075844044 10:125530675-125530697 CCATGGCCCTGTCAGCAGCAGGG No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data
1075844047_1075844052 10 Left 1075844047 10:125530682-125530704 CCTGTCAGCAGCAGGGCAGAGTT No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data
1075844046_1075844052 11 Left 1075844046 10:125530681-125530703 CCCTGTCAGCAGCAGGGCAGAGT No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data
1075844041_1075844052 24 Left 1075844041 10:125530668-125530690 CCCAAGGCCATGGCCCTGTCAGC No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data
1075844042_1075844052 23 Left 1075844042 10:125530669-125530691 CCAAGGCCATGGCCCTGTCAGCA No data
Right 1075844052 10:125530715-125530737 GAAGTCCAGCCCTAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075844052 Original CRISPR GAAGTCCAGCCCTAGATCTA GGG Intergenic