ID: 1075844444

View in Genome Browser
Species Human (GRCh38)
Location 10:125534213-125534235
Sequence GCTTCCTCCTCTCCTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075844438_1075844444 -7 Left 1075844438 10:125534197-125534219 CCAGGTCTTGCCCCCAGCTTCCT No data
Right 1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG No data
1075844437_1075844444 -6 Left 1075844437 10:125534196-125534218 CCCAGGTCTTGCCCCCAGCTTCC No data
Right 1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG No data
1075844435_1075844444 17 Left 1075844435 10:125534173-125534195 CCTGGTGGGAGCAAAGAGGGATG No data
Right 1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG No data
1075844434_1075844444 18 Left 1075844434 10:125534172-125534194 CCCTGGTGGGAGCAAAGAGGGAT No data
Right 1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075844444 Original CRISPR GCTTCCTCCTCTCCTGCTGT GGG Intergenic
No off target data available for this crispr