ID: 1075847602

View in Genome Browser
Species Human (GRCh38)
Location 10:125557540-125557562
Sequence ATGTTGAAGGGAAACTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075847602_1075847607 2 Left 1075847602 10:125557540-125557562 CCCTCCAAGTTTCCCTTCAACAT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075847602 Original CRISPR ATGTTGAAGGGAAACTTGGA GGG (reversed) Intergenic
No off target data available for this crispr