ID: 1075847607

View in Genome Browser
Species Human (GRCh38)
Location 10:125557565-125557587
Sequence TCTTTTTCATCATCTAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075847598_1075847607 21 Left 1075847598 10:125557521-125557543 CCTATCCCCTGGATTTTCTCCCT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847599_1075847607 16 Left 1075847599 10:125557526-125557548 CCCCTGGATTTTCTCCCTCCAAG No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847603_1075847607 1 Left 1075847603 10:125557541-125557563 CCTCCAAGTTTCCCTTCAACATC No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847600_1075847607 15 Left 1075847600 10:125557527-125557549 CCCTGGATTTTCTCCCTCCAAGT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847601_1075847607 14 Left 1075847601 10:125557528-125557550 CCTGGATTTTCTCCCTCCAAGTT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847597_1075847607 22 Left 1075847597 10:125557520-125557542 CCCTATCCCCTGGATTTTCTCCC No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847602_1075847607 2 Left 1075847602 10:125557540-125557562 CCCTCCAAGTTTCCCTTCAACAT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847604_1075847607 -2 Left 1075847604 10:125557544-125557566 CCAAGTTTCCCTTCAACATCATC No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data
1075847605_1075847607 -10 Left 1075847605 10:125557552-125557574 CCCTTCAACATCATCTTTTTCAT No data
Right 1075847607 10:125557565-125557587 TCTTTTTCATCATCTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075847607 Original CRISPR TCTTTTTCATCATCTAAGTC TGG Intergenic
No off target data available for this crispr