ID: 1075850239

View in Genome Browser
Species Human (GRCh38)
Location 10:125580848-125580870
Sequence GTCCCAGGAAAGGACTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075850239_1075850243 -5 Left 1075850239 10:125580848-125580870 CCATCAGAGTCCTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 36
4: 234
Right 1075850243 10:125580866-125580888 GGGACTTTCCTGCCTGGAGCTGG No data
1075850239_1075850244 -1 Left 1075850239 10:125580848-125580870 CCATCAGAGTCCTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 36
4: 234
Right 1075850244 10:125580870-125580892 CTTTCCTGCCTGGAGCTGGAAGG No data
1075850239_1075850245 0 Left 1075850239 10:125580848-125580870 CCATCAGAGTCCTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 36
4: 234
Right 1075850245 10:125580871-125580893 TTTCCTGCCTGGAGCTGGAAGGG No data
1075850239_1075850248 24 Left 1075850239 10:125580848-125580870 CCATCAGAGTCCTTTCCTGGGAC 0: 1
1: 0
2: 1
3: 36
4: 234
Right 1075850248 10:125580895-125580917 AGAGTCCTCTATAATCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075850239 Original CRISPR GTCCCAGGAAAGGACTCTGA TGG (reversed) Intronic
900972074 1:5997243-5997265 GTCCCAGGAAACCACGCAGAAGG - Intronic
901175786 1:7298134-7298156 CTCCCAGGGAAGGATTCTCAAGG + Intronic
901755506 1:11439183-11439205 TTCCCATGAAAGCACTTTGAAGG - Intergenic
901943436 1:12681678-12681700 GTCCCAGGAATGGGCTGGGAAGG - Intergenic
902184681 1:14716498-14716520 GTCCAAGGGAAGGATTATGAGGG - Intronic
902436783 1:16403200-16403222 GTCCCAGGAAAGGAATTCGATGG - Intronic
902904204 1:19542601-19542623 GTCCCAGGTCAGGCCCCTGATGG - Intergenic
902990034 1:20180859-20180881 GGTCCAGGAAAGGACCCAGATGG - Intergenic
904269574 1:29340967-29340989 GTCAAAGGCAAGGACTGTGATGG + Intergenic
904476640 1:30769297-30769319 GGCCCAGGAAAGTACCGTGACGG - Intergenic
905959711 1:42033448-42033470 GTCATAGGAAAGGACTAGGAGGG - Intronic
907404442 1:54245279-54245301 CTCCCAGAAAAGGAGACTGAAGG + Intronic
908036227 1:60057038-60057060 GGCCTAGGAAAAAACTCTGATGG + Intronic
908182871 1:61623552-61623574 GACCCATGCAAGGACTCTGCTGG - Intergenic
908527616 1:65002834-65002856 GTCCCAGGAAAGCGCTGTGGCGG + Intergenic
912090124 1:106062244-106062266 AACCCAGGAAAGGACTGAGAAGG - Intergenic
912230828 1:107790538-107790560 GTTCCAGGTAAGTTCTCTGAGGG + Intronic
912555756 1:110514819-110514841 GTGCCCTGAAAGGACACTGAAGG + Intergenic
912795987 1:112693966-112693988 GTCCCAGGGATGGACGCTGGAGG - Intronic
913182027 1:116331360-116331382 GTCCCAGAGGAGGACTCAGAAGG - Intergenic
915732627 1:158065050-158065072 ATACCAGGCAAGCACTCTGAAGG - Intronic
916550870 1:165848869-165848891 GTCATAGGAAAGCACTCAGATGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918387986 1:184029782-184029804 GTTCCAGGCAGGTACTCTGAAGG - Intronic
919573753 1:199280699-199280721 GTTCCAGGCCAGCACTCTGATGG + Intergenic
919807501 1:201389048-201389070 GGCCCAGGAAATGAGGCTGAAGG - Intronic
920528076 1:206683612-206683634 GCCCCAGGAAAGGACAGTGTTGG + Intronic
922701494 1:227763776-227763798 CACCCAGGAAAGGCCTCTGCTGG - Intronic
923195937 1:231667361-231667383 GGCTCAGGAAAGGTCACTGAAGG - Intronic
1063100292 10:2944599-2944621 ACCCCAGGAAAGGACTGTGCTGG + Intergenic
1063113253 10:3054222-3054244 TTCACATGAAAGGAATCTGAAGG + Intergenic
1063226231 10:4017391-4017413 GTCGCAGGAGAAGACCCTGAAGG - Intergenic
1066449980 10:35520129-35520151 TTTCCAGGGAAGGATTCTGATGG - Intronic
1067190436 10:44063699-44063721 TGTCCAGGGAAGGACTCTGAAGG + Intergenic
1067808987 10:49412532-49412554 GTCCAAGTAAAGGAGTCTGGTGG + Intergenic
1068093476 10:52461276-52461298 GTGCCAGGGTAGGATTCTGAAGG - Intergenic
1068431534 10:56938456-56938478 GTTCATGGAAAGGACTCTGATGG - Intergenic
1068756756 10:60663553-60663575 GTCACAGGAATGGAGTCTAAGGG - Intronic
1069651736 10:70053877-70053899 GGCGCAGGAAAGGGCTCTGCCGG + Intronic
1069821519 10:71231411-71231433 GGGCCAGGAAAGGACTCTCTGGG - Intronic
1071492341 10:86144406-86144428 CTGCCAGGAAAGGAAGCTGAGGG + Intronic
1072836009 10:98713043-98713065 GACTCAAGAAAGCACTCTGATGG + Intronic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1076090374 10:127680495-127680517 GTCCCAGCTAAGAACTATGAAGG + Intergenic
1076686408 10:132200244-132200266 GTCCCAGGCAAGGAAAGTGAGGG + Intronic
1078066744 11:8083618-8083640 GGCCCAGGAAAGGAATTGGAGGG - Intronic
1078465894 11:11550042-11550064 CCTCCAGGACAGGACTCTGATGG + Intronic
1078478375 11:11654418-11654440 GTCCAAGAAAAAGATTCTGAAGG + Intergenic
1080308482 11:30862570-30862592 GTCCCAGCTAAGAACTCAGAAGG + Intronic
1080948629 11:37003390-37003412 GTCCCAAGGAGGGACTCTGGAGG - Intergenic
1082013030 11:47463457-47463479 GGCCCAGGAAGAGAGTCTGAGGG + Intergenic
1083583563 11:63840027-63840049 GTCCAGGGCAAGGACCCTGAGGG - Intronic
1083666689 11:64279154-64279176 GTCCCTGGGAATGAGTCTGAGGG - Intronic
1084083562 11:66844279-66844301 GGCCCAGGAAAAGAATCTGAGGG - Exonic
1085305236 11:75482052-75482074 GTCCCGGGAAAGGAGTGTGAAGG - Intronic
1087399675 11:97649738-97649760 GTCACAGGAAATGACACTTATGG - Intergenic
1089086273 11:115819614-115819636 GTAGCAGAAAAAGACTCTGATGG - Intergenic
1089369740 11:117947006-117947028 TTCCCAGGAAATGACTCAGGGGG - Intergenic
1089523432 11:119080974-119080996 GTCCCTGGTAAGGCCCCTGAAGG - Intronic
1094241382 12:28229706-28229728 ATCCCAGGGAAGGACTCTGATGG + Intronic
1094474436 12:30830514-30830536 GTCCCAGAAAAGGACACTGTTGG - Intergenic
1096819877 12:54225625-54225647 GTCCCAGGAAGGGAATGAGAAGG - Intergenic
1101856684 12:108449535-108449557 ATCCCAGAGAAGGATTCTGATGG + Intergenic
1103622946 12:122200111-122200133 GACCCGGGACAGGACTGTGAGGG - Intronic
1104357259 12:128098876-128098898 GTCACAGAAATGGACTCTGTGGG + Intergenic
1104650620 12:130529660-130529682 CTCCCAGCAAAAGAGTCTGAAGG + Intronic
1104731339 12:131107139-131107161 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1104731352 12:131107191-131107213 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1104731365 12:131107243-131107265 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1104731375 12:131107295-131107317 ATCCCAGCGAAGGGCTCTGATGG + Intronic
1104731389 12:131107347-131107369 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1104731403 12:131107399-131107421 ATCGCAGGGAAGGGCTCTGATGG + Intronic
1104731414 12:131107451-131107473 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1104731428 12:131107503-131107525 ATCCCAGGGAAGGGCTCTGATGG + Intronic
1107518357 13:41154356-41154378 ATTCATGGAAAGGACTCTGATGG - Intergenic
1107671076 13:42746849-42746871 ATCACAGGAAATGATTCTGAGGG - Intergenic
1107804401 13:44140813-44140835 GTCCCAGAAAAGGATTTTAAAGG + Intergenic
1109058527 13:57582603-57582625 GTCCTAGGAAAGTACTCAGGCGG + Intergenic
1111074638 13:83217644-83217666 GTCACAGGATAAGACTTTGATGG + Intergenic
1115407507 14:33034711-33034733 GTTCCAGGAAAGGACTATCTGGG - Intronic
1116583300 14:46670265-46670287 GGGTCAGGAAAGGACTCTGCAGG + Intergenic
1118563878 14:67118095-67118117 GTCCCAGGTAAGAACTCACAAGG - Intronic
1118974369 14:70664425-70664447 GGCCCAGGCCAGGACTCTTAAGG - Intronic
1119559451 14:75578612-75578634 GGCCCGGGAGAGGACTCTGCGGG + Exonic
1121447292 14:93987251-93987273 GTCCCAGGAAAGGACTGCAGAGG + Intergenic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1123912715 15:24984480-24984502 GTCCAAAGAAAGGATTCTGAAGG - Intergenic
1124213516 15:27784271-27784293 GTACCACGAGAGGAATCTGAAGG + Intronic
1124908699 15:33897133-33897155 TTGCCAGGAAAGGACTGGGAAGG + Intronic
1125425048 15:39540178-39540200 GTACCAGGAAAGGAGTAAGAAGG + Intergenic
1125756682 15:42069849-42069871 GGCCCAGGGCAGGCCTCTGAGGG + Intronic
1128129217 15:65214658-65214680 GAGACAGGAAAGGACTCTGATGG - Intergenic
1130660659 15:85829393-85829415 CTCCCAGGTAACAACTCTGAAGG + Intergenic
1131249154 15:90819438-90819460 GTGCCAGGATGGCACTCTGATGG + Intergenic
1131551125 15:93357927-93357949 TTCCCAGGAAAGGGCACGGAAGG - Intergenic
1132225914 15:100141315-100141337 GTCCCTGTCAAGGACTGTGAAGG + Intronic
1132516559 16:368728-368750 GTCCCAGGACAGGACAGAGAAGG + Intronic
1132544267 16:526109-526131 GTGCCAGGGAAGGACTGGGAAGG + Intergenic
1132975830 16:2710639-2710661 GCCCCAGGAAAGAAGTCTGTGGG - Intergenic
1135385620 16:22037049-22037071 AACCCAGGAAAGAACCCTGAAGG + Intronic
1135551341 16:23400531-23400553 GCCCCAGGAAAGGCCTCAAAGGG + Intronic
1136998984 16:35212420-35212442 ATCCCAGGAAAGGGATGTGAAGG + Intergenic
1138371163 16:56527488-56527510 GTCCCAGCTAAGAACTCAGAAGG + Intergenic
1138563438 16:57815819-57815841 GTGGCAGGAAAGGAGTCTGGGGG - Intronic
1138770142 16:59653169-59653191 TTATCAGGAGAGGACTCTGAGGG - Intergenic
1138789663 16:59888283-59888305 CATCCAGGCAAGGACTCTGAGGG + Intergenic
1139188563 16:64835763-64835785 ACCCCAGGACAGAACTCTGATGG + Intergenic
1139473997 16:67193355-67193377 GTCCCCAGAACGGTCTCTGAGGG + Intronic
1141055237 16:80807643-80807665 ATCCCAGGGAAGGACTCTATTGG + Intergenic
1143857109 17:9860115-9860137 TCCCCAGGAAAGGAAGCTGAAGG - Intronic
1147566488 17:41539385-41539407 ATCCCAGGCAAGGACTTTGGAGG - Intergenic
1147574048 17:41588512-41588534 CTGCCAGCAAAGGACTCTCAAGG + Intergenic
1148776639 17:50099362-50099384 GTTTCAGGAAGGGACTCTGCAGG - Intronic
1149043686 17:52220006-52220028 GTCCCAGGTAAAGACTCAGAAGG - Intergenic
1149426209 17:56557284-56557306 GTTCCAGGGAAAGATTCTGATGG + Intergenic
1150270838 17:63863700-63863722 GTCCAGGGACAGGACTTTGAAGG + Intergenic
1150274466 17:63887231-63887253 GTCCAAGGACAGGACTTTGAAGG + Intergenic
1150276604 17:63902029-63902051 GTCCATGGACAGGACTTTGAAGG + Intergenic
1150660133 17:67068016-67068038 GAGCCAGTGAAGGACTCTGAAGG - Intergenic
1151302345 17:73236503-73236525 GTCACAGGAAAGGAGTCTCAAGG + Exonic
1151579997 17:74972377-74972399 TTCCCAGGAGAGGAGGCTGAGGG + Intronic
1153625840 18:7021274-7021296 GCCACAGGACAGGACTGTGAAGG - Intronic
1155717978 18:28970404-28970426 GTTCCAGGATGGGACTCTTAAGG + Intergenic
1156406142 18:36784325-36784347 GCCCCAGGAAAGGGCCCTAAGGG - Intronic
1157819244 18:50753439-50753461 GTTCCAGAAGAGAACTCTGAGGG + Intergenic
1157891293 18:51420566-51420588 TTCCCAATAAAGGAATCTGATGG - Intergenic
1157984623 18:52423048-52423070 GTCCCAGGAAAGGAGGTTAAAGG - Intronic
1160211000 18:76879634-76879656 GTCAGAGGAAAGGGCTGTGATGG - Intronic
1160506955 18:79432612-79432634 CTCCCAGAAACGGACTCTGATGG + Intronic
1160657699 19:281873-281895 GTCCCAGGGGAGGACTTTGGGGG + Intronic
1161299636 19:3536582-3536604 GTCCCAGGAGGAGCCTCTGAAGG - Intronic
1162693527 19:12453193-12453215 ATTCAAGGAAAGGACTTTGAAGG + Intronic
1164503086 19:28835741-28835763 GTCCCAGGGCAGGAGTCTGGAGG - Intergenic
1166142302 19:40811613-40811635 GGCCCAGGAGACGACTCTGAGGG - Intronic
1168153983 19:54463206-54463228 GTCCCAGCAAAAGGCGCTGAAGG + Exonic
1168623519 19:57898037-57898059 ATCCAAGGAAAGGACTTTGAAGG + Intronic
926762023 2:16286435-16286457 TGCCCAGGAAAGGAAGCTGAAGG + Intergenic
926964907 2:18399243-18399265 GTCTCAGCAATGAACTCTGATGG - Intergenic
926969475 2:18452399-18452421 GCCCCACGGAAGGACTCTGATGG - Intergenic
928305635 2:30168089-30168111 TTCTCAGGAAGGGACACTGATGG - Intergenic
928548240 2:32348124-32348146 GTGGTAGGAAAGGGCTCTGAAGG - Intergenic
930058582 2:47270742-47270764 GTCCCAGCTAAGGACTCAGAAGG - Intergenic
931994661 2:67828458-67828480 GTCCAAGGAAAGTGGTCTGAGGG - Intergenic
935828083 2:106971600-106971622 GTCCCACGGAAGGACTCTAGGGG + Intergenic
935858853 2:107305165-107305187 GTCTCAAGAAAGGTCGCTGAGGG - Intergenic
937511685 2:122602407-122602429 GTCCCAGCTAAGAACTATGAAGG - Intergenic
937791579 2:125968085-125968107 GTCTCTGGCTAGGACTCTGATGG + Intergenic
937908577 2:127064568-127064590 GTCCCAGGAGAGGGCTTTGTGGG - Intronic
938201686 2:129377500-129377522 GTCCCTGGCAAGGACTCAGAGGG + Intergenic
938262026 2:129903222-129903244 GTCTCTGGAAAGGTCTCTGCTGG + Intergenic
939857387 2:147376137-147376159 ATCTCAGGAAATGAATCTGAAGG - Intergenic
940926081 2:159364958-159364980 GTCTCAGGCAGAGACTCTGATGG + Intronic
941764921 2:169286212-169286234 GTCACAGAAAAGGTCTCTGCAGG + Intronic
942250845 2:174046713-174046735 GTACAAGGAAAGGAATATGAGGG - Intergenic
942370728 2:175281394-175281416 GTCCTAGCAAAGGCCACTGATGG - Intergenic
942373932 2:175316359-175316381 GTTCGAGGAAAGTAGTCTGAGGG + Intergenic
943680914 2:190766719-190766741 GAACCAGCAGAGGACTCTGAAGG - Intergenic
945522641 2:210847354-210847376 GTCCCAGGATTGGACACTGTAGG + Intergenic
946546239 2:220747217-220747239 GACCCAGGAAAACAGTCTGATGG + Intergenic
946988644 2:225302937-225302959 TTCCCAAGTAAGGACTCTGTAGG - Intergenic
947868092 2:233415377-233415399 GTTCCAGGAAAGCTCTTTGAGGG - Intronic
948402675 2:237694913-237694935 GTCCCAAGAAAGGGCTGTTAGGG + Intronic
948559859 2:238845626-238845648 TGCCCAGGTAATGACTCTGAGGG + Intergenic
948806840 2:240456717-240456739 GCCCCAGGAAAGGACCCGGAGGG + Intronic
948902953 2:240965374-240965396 CTCCCAGGTGAGGACACTGAAGG + Intronic
949080785 2:242097503-242097525 GGCCCTGAGAAGGACTCTGAGGG + Intergenic
1170269163 20:14504628-14504650 TTCCCAGGAAATAACTCTGAGGG - Intronic
1172277999 20:33691185-33691207 ATGCCAGGGAAGGACTCTGGTGG - Intergenic
1173179268 20:40790133-40790155 GTCCCAGGAATGTACTCCCACGG - Intergenic
1173361139 20:42345781-42345803 GGCTCAGGAAAGAACTATGAAGG + Intronic
1174776616 20:53348808-53348830 CTCCCAGGAGAGTACTTTGAAGG - Intronic
1175037981 20:56018362-56018384 GTGACACGAAAGGACTGTGAAGG + Intergenic
1175324105 20:58110572-58110594 GTCCCAGGAGATGCCTCTCAGGG - Intergenic
1175518021 20:59581221-59581243 GTCACAGGAAAGAAAACTGAAGG - Intronic
1175762498 20:61571132-61571154 GACACAGGAAAGGACCCTGCAGG - Intronic
1179045743 21:37843755-37843777 GTGCCAGGAAAGGATTTAGAGGG + Intronic
1179450567 21:41465830-41465852 GCCCCTGGAAAGGACTCAGCAGG + Exonic
1180868083 22:19131087-19131109 TCCCCAGGACAGGACTCTGGTGG - Exonic
1183706395 22:39477274-39477296 GACCCAGGAGAGGAGTCTGCAGG + Intronic
1183954776 22:41372888-41372910 GTCCCAGGAAGGGCCTTTGCAGG - Intronic
1184289910 22:43493111-43493133 GTCCCAGGAGATGGCTCTGTAGG + Intronic
1184671306 22:46013538-46013560 TTCCCAGGAAAGGTCGCTGGGGG + Intergenic
1185029606 22:48434746-48434768 GTCCCTGGAAAGGACTGTGGAGG + Intergenic
949797729 3:7869070-7869092 ATCCCAGGCAAGCACTCTGATGG - Intergenic
951710945 3:25584495-25584517 GGCCCAAGAAAAGACACTGATGG + Intronic
952147821 3:30552347-30552369 GTCCCAGTTAAGAACTATGAAGG + Intergenic
952266790 3:31794697-31794719 GTCTCAGGTCAGGACTCTGAGGG + Intronic
952327610 3:32335234-32335256 CTCCCAGGAAAGGAGTGGGATGG - Intronic
953713385 3:45294457-45294479 GTCCCAGGGAAGAACCCAGATGG + Intergenic
954235894 3:49256949-49256971 GCCCCAGGAAGGGGCTTTGAGGG - Exonic
956701274 3:71961112-71961134 GTCCCAGCTAAGAACTATGAAGG - Intergenic
957372269 3:79310334-79310356 GTCCCAGGAGAGGAAGGTGAGGG - Intronic
958007008 3:87824684-87824706 GTCCCAGTCCAGGACACTGATGG - Intergenic
961002608 3:123384183-123384205 GCCCCAAGAAAAGACCCTGAGGG + Intronic
961507321 3:127378613-127378635 GTCTGAGGAAAGGAGTCTCAGGG - Intergenic
962396151 3:135016847-135016869 GTCCCGAGAAAGGAGCCTGATGG - Intronic
963557304 3:146808671-146808693 GACCAAGGAAAGGAGTGTGAAGG + Intergenic
963863093 3:150330766-150330788 GACCCAGGACAGGTCTCTGAAGG - Intergenic
964409264 3:156381351-156381373 GTCCCAGTAGAGGATACTGAGGG + Intronic
967111217 3:186295721-186295743 TTCCCATGAAAGGTCTCTCATGG - Intronic
968831679 4:2935333-2935355 GTCCCAGGACAGGCGGCTGAGGG + Intergenic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
970062225 4:12047660-12047682 GTCCCAGTAAAATACTCTGCTGG - Intergenic
971157679 4:24100813-24100835 TTCCCAGGAAAGCATTATGACGG + Intergenic
976086299 4:81410390-81410412 TCCCCAGTAAAGGACACTGATGG + Intergenic
977487948 4:97672673-97672695 GTCAAAGGAAAGGACTTTTAGGG + Intronic
978081855 4:104602934-104602956 GTCCCATGAAAGGAGTTTGAAGG + Intergenic
978307432 4:107346416-107346438 ATCTCAGGAAAGGACTGTGGAGG + Intergenic
980409853 4:132403258-132403280 TTCCCAGGAAAGAATTCAGAAGG - Intergenic
980963505 4:139499231-139499253 GTTCAAGGAAAGGACTATTATGG - Intronic
981953696 4:150443973-150443995 CTCCCATGAAAGGATTCTAATGG - Intronic
985905657 5:2833849-2833871 AACCCAGGAAAGGCCTCAGAGGG + Intergenic
989247488 5:39270206-39270228 ATCCCAGGAAAGGACTCCAGTGG - Intronic
990113219 5:52354141-52354163 GTCCCTTCAAAGGACTGTGAAGG + Intergenic
990983315 5:61620451-61620473 GTGACAGGAAAGGACTCAGATGG + Intergenic
991093668 5:62717462-62717484 GTCCCAGCTAAGAACTCAGAAGG - Intergenic
992482275 5:77163951-77163973 GTCCCTGTTAAGGACACTGAAGG + Intergenic
997202409 5:132019188-132019210 TTCCCAGGGAAGAACTCTGATGG - Intergenic
999367973 5:151035197-151035219 GCCCCGGGAAAGGGCCCTGAGGG + Intronic
999394892 5:151221104-151221126 GTCCCAGGCCAGGCCTCTCAGGG + Intronic
1001588867 5:172852017-172852039 ATCCCAGGCAGGGACTCTGACGG + Intronic
1001813938 5:174651808-174651830 CTCCCTGGAGAGGTCTCTGAAGG + Intergenic
1002280429 5:178126758-178126780 CTCACAGGAAAGGATACTGAAGG + Intergenic
1002916790 6:1535623-1535645 GGCCCAGGAAAAGACTGTCAAGG - Intergenic
1003607827 6:7580825-7580847 TTCCCAGGAGAGGACTGTGAAGG + Exonic
1005638444 6:27772795-27772817 GTCAGAGGAAAGCTCTCTGAAGG + Intergenic
1008861315 6:56152913-56152935 GTCCCAGGAAAGGGGTCTGCAGG + Intronic
1009748180 6:67847479-67847501 GTCCCAGGAGAGGGGACTGATGG - Intergenic
1012110522 6:95225280-95225302 GTACCATGAATGGACACTGAGGG + Intergenic
1013712024 6:112912600-112912622 GTCTCAGGAAAGAACTCTTTGGG - Intergenic
1016353035 6:143188482-143188504 GTCACAGGAAGGGAAGCTGAAGG - Intronic
1017060392 6:150478921-150478943 GTTCCAGGACAGGTCTCTAAAGG - Intergenic
1017550909 6:155506341-155506363 CTCCTAGGAGAGGTCTCTGAAGG + Intergenic
1019065069 6:169289536-169289558 GCCCCAGGAGGGGAATCTGATGG + Intergenic
1019703633 7:2487358-2487380 GACCCAGGACAGGACGCTGGAGG + Intergenic
1022812526 7:33884044-33884066 GTCCCAAGAAAGTAGTCTCATGG - Intergenic
1023527217 7:41117321-41117343 ATCCCAGGAAAGGGATCTGCTGG + Intergenic
1024246824 7:47477125-47477147 ATCCCAGGACAGGACTGTAAGGG - Intronic
1024506363 7:50165508-50165530 ATCCCAGGAAAGGACCCATAGGG - Intergenic
1026701076 7:72645780-72645802 TGACCAGGAAAGAACTCTGAAGG + Intronic
1027174091 7:75892395-75892417 GACCCAGGCAAGGTCTCTGCTGG + Intergenic
1028198360 7:87933587-87933609 CTCCCAGGGAAGGTCTCTGCAGG - Intergenic
1030680487 7:112428671-112428693 ATGCAAGGAAAGGAGTCTGAAGG - Intronic
1033051831 7:138011574-138011596 GTTCATGGAGAGGACTCTGATGG - Intronic
1033422681 7:141217440-141217462 GTCCCAGGAAGGAACTGGGATGG + Intronic
1033790474 7:144787011-144787033 GTCCCAGCTAAGAACTCAGAAGG + Intronic
1034431313 7:151042586-151042608 GCCCCAGGAGAGGGCTCTGGTGG + Intronic
1034870707 7:154680895-154680917 GTCCCAGAAAATATCTCTGAAGG - Intronic
1035404466 7:158588397-158588419 GTCCCAGGAAAGCTCCCGGAGGG + Intergenic
1035538827 8:415678-415700 GGCCCTGAGAAGGACTCTGAGGG + Intronic
1036205603 8:6803640-6803662 GACTCAGGAAAGGGCTCAGAAGG + Intergenic
1037763352 8:21756684-21756706 GTGCCAGGCAAGGACTGTGAGGG - Intronic
1039869105 8:41530221-41530243 TTCCTGGGACAGGACTCTGATGG + Exonic
1041201009 8:55452024-55452046 GTTCCAGGACAGGGTTCTGAGGG + Intronic
1041880310 8:62742039-62742061 GTCCCAGCTAAGAACTCAGAAGG - Intronic
1042004015 8:64160379-64160401 GTCCCAACTAAGGACTATGAAGG + Intergenic
1042137263 8:65644493-65644515 TTCCCAGGACAGGACGGTGAAGG + Intergenic
1046180408 8:110638647-110638669 TTCCCAAGAAATGACTCTCATGG - Intergenic
1049618698 8:143588238-143588260 GAGTCAGGGAAGGACTCTGAAGG - Intronic
1052670752 9:31554071-31554093 GTCCCAGGAAATGTTTCTTAGGG - Intergenic
1055629874 9:78212501-78212523 GTCCCAGCGTGGGACTCTGAGGG - Intergenic
1056528875 9:87469600-87469622 GTCTCAGGAAAGGCCTCTAGGGG - Intergenic
1058655161 9:107213711-107213733 GTTACAGGAAATGACTCAGAGGG - Intergenic
1058885475 9:109319430-109319452 GCCCCAGCAAAGGGCTCTGCCGG + Intronic
1059092759 9:111378283-111378305 AGCCCATGGAAGGACTCTGAAGG + Intronic
1059352204 9:113673413-113673435 CCCCCAGGGAAGGACTCTGATGG - Intergenic
1060199275 9:121642890-121642912 GGTCCAGGGAAGGTCTCTGAGGG + Intronic
1060208468 9:121696488-121696510 GTCCCAGGAGCTGCCTCTGAAGG + Intronic
1185746885 X:2580836-2580858 GTTCCAGGAAAGCATCCTGAGGG + Intergenic
1185999300 X:4989909-4989931 GACCCAGGATAGAACCCTGAAGG - Intergenic
1197276117 X:124481433-124481455 GTGCCAGGGAGGCACTCTGAGGG + Intronic
1197278031 X:124502754-124502776 GTCCCAGTGTGGGACTCTGAAGG - Intronic