ID: 1075850566

View in Genome Browser
Species Human (GRCh38)
Location 10:125583174-125583196
Sequence AATTTACAACATATGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075850566_1075850569 -6 Left 1075850566 10:125583174-125583196 CCCTGATACATATGTTGTAAATT 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1075850569 10:125583191-125583213 TAAATTTCACTAATTTGAACGGG No data
1075850566_1075850568 -7 Left 1075850566 10:125583174-125583196 CCCTGATACATATGTTGTAAATT 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1075850568 10:125583190-125583212 GTAAATTTCACTAATTTGAACGG No data
1075850566_1075850570 -3 Left 1075850566 10:125583174-125583196 CCCTGATACATATGTTGTAAATT 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1075850570 10:125583194-125583216 ATTTCACTAATTTGAACGGGTGG No data
1075850566_1075850572 6 Left 1075850566 10:125583174-125583196 CCCTGATACATATGTTGTAAATT 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1075850572 10:125583203-125583225 ATTTGAACGGGTGGAGAGGAAGG No data
1075850566_1075850571 2 Left 1075850566 10:125583174-125583196 CCCTGATACATATGTTGTAAATT 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1075850571 10:125583199-125583221 ACTAATTTGAACGGGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075850566 Original CRISPR AATTTACAACATATGTATCA GGG (reversed) Intronic
901287078 1:8089020-8089042 AATTTAAAATATATGTACCATGG - Intergenic
907535797 1:55155454-55155476 AATATACAATATATAAATCATGG + Intronic
909150854 1:72002807-72002829 AATTTACCACATATCTCTCATGG + Intronic
909226244 1:73026902-73026924 AATTTAGATCAGATGAATCAAGG + Intergenic
909809805 1:79918627-79918649 AATTTAAAACATTTGTTTCATGG + Intergenic
910196091 1:84641004-84641026 TCTTTAGAACATATGTACCAAGG + Intergenic
914976758 1:152372031-152372053 AATTTTCAACAGATGTACAAAGG + Intergenic
918881305 1:190125440-190125462 AATGTACAACATATTCTTCAAGG - Intronic
919261559 1:195201900-195201922 AATTTAAAATATATGTATAATGG + Intergenic
919317547 1:195992499-195992521 AATGTACAAGATAGGTAACACGG + Intergenic
919363043 1:196619338-196619360 AATATACAACTTATGAATCTGGG + Intergenic
919424497 1:197412790-197412812 TATTTAAAACTTATTTATCAAGG - Intronic
920893647 1:210020698-210020720 AATTTACTTTATATGTAACATGG + Intronic
923409944 1:233697799-233697821 TATTTACAACATATGTTGCTAGG - Intergenic
923736525 1:236614201-236614223 AATTTAAACTATATATATCAAGG - Intergenic
1063289172 10:4724070-4724092 TATTTTAAAAATATGTATCAAGG - Intergenic
1063550242 10:7025699-7025721 AATGTAATACATATATATCATGG + Intergenic
1063611575 10:7567265-7567287 TAGGTACAAAATATGTATCAGGG - Intronic
1063833418 10:9983584-9983606 AATGTACTACATATATATCATGG - Intergenic
1064798548 10:19041810-19041832 AATTTAAAACATATTCATTAGGG + Intergenic
1067331844 10:45329963-45329985 AATATACAACATGATTATCAAGG - Intergenic
1068755972 10:60653432-60653454 AATTTTCAACAAAAATATCAAGG - Intronic
1068831565 10:61501677-61501699 AATTTACAACAGAACTATCCAGG + Intergenic
1068975319 10:63002746-63002768 CATTTAAAAAATATTTATCAAGG - Intergenic
1069259052 10:66371178-66371200 AATTTAACACATCTGTATCCTGG - Intronic
1074142988 10:110692047-110692069 AATTTTCAACAGGTGTACCAAGG - Intronic
1074310959 10:112323121-112323143 AATTTCCAAAATGTGTATCAAGG + Intergenic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1077920524 11:6638762-6638784 AATCTTGAACATATGAATCAAGG + Intronic
1078608517 11:12798741-12798763 GTTTTACAACATTTGTACCATGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079938146 11:26643403-26643425 AAGTTTCAACATATGAATCTGGG - Intronic
1080293080 11:30693260-30693282 AATGTGGTACATATGTATCATGG + Intergenic
1080444986 11:32330451-32330473 CATTTACAAAATATGTGTGAAGG + Intergenic
1080540688 11:33261574-33261596 AATATGCTACATATGTACCATGG - Intronic
1082275869 11:50220999-50221021 AATTTACAACATCCATATCCTGG - Intergenic
1082321862 11:51079838-51079860 ATTTTTCACCATAGGTATCAAGG - Intergenic
1082321986 11:51082574-51082596 ATTTTTCACCATAGGTATCAAGG - Intergenic
1082322109 11:51085310-51085332 ATTTTTCACCATAGGTATCAAGG - Intergenic
1082322245 11:51088387-51088409 ATTTTTCACCATAGGTATCAAGG - Intergenic
1084291187 11:68169373-68169395 CATTTACCAAATATTTATCAAGG + Intronic
1085189981 11:74611363-74611385 AAATTATAACATATGTTTTAAGG + Intronic
1085367415 11:75963145-75963167 AATATGCAAAATATGTATCATGG - Intronic
1085509234 11:77078339-77078361 AATTTTCAACAAAAGTACCAAGG - Intronic
1087626877 11:100605326-100605348 AATTTAGAAAATATATTTCAGGG + Intergenic
1087967165 11:104430599-104430621 AATTTAAAAAATTTGTATAAAGG + Intergenic
1088165686 11:106933726-106933748 AATGTAGTACATATATATCATGG + Intronic
1088176446 11:107057970-107057992 AAATTAAAAAATATGTATCCAGG + Intergenic
1089656821 11:119953865-119953887 AATGTTCAACATATATCTCATGG + Intergenic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1090456385 11:126853265-126853287 AATTTACAAAATATGTATTTTGG + Intronic
1091086965 11:132730463-132730485 AATTGACATCGTATTTATCAAGG - Intronic
1091338015 11:134787058-134787080 TTTTTACCACATATGTCTCATGG + Intergenic
1093050177 12:14495298-14495320 AAACTACAACATATGTGTGATGG - Intronic
1093104779 12:15073122-15073144 AATCTTCAATATTTGTATCATGG + Intergenic
1094074005 12:26452513-26452535 AATTTCCAACACATGCATTATGG - Intronic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1096611420 12:52804484-52804506 AGTTTCAAACATATGAATCAAGG + Intergenic
1096664232 12:53151941-53151963 AATTAACAAAATGTATATCATGG - Intergenic
1097803573 12:63941125-63941147 AATTTAATATATATTTATCAGGG - Intronic
1097922545 12:65092068-65092090 AATGTGGAACATATGTACCATGG + Intronic
1099317406 12:81101974-81101996 TATTTTCAACATATTTAACAAGG - Intronic
1099319429 12:81126562-81126584 AAATTTTAACATAAGTATCAAGG + Intronic
1100132041 12:91507331-91507353 AATGAAGTACATATGTATCATGG + Intergenic
1101469143 12:104978591-104978613 GATTTTCGACATAGGTATCAAGG - Intergenic
1104537497 12:129631846-129631868 AAGTTACAACATATTAACCAGGG - Intronic
1104728323 12:131091628-131091650 AATATGCAACATTTGTATCTTGG + Intronic
1105204814 13:18212253-18212275 CATTTAAAAAATATGTATCTTGG + Intergenic
1105204910 13:18213501-18213523 CATTTAAAAAATATGTATCTTGG + Intergenic
1107043049 13:35969058-35969080 AATTACCACCATATGTAACAAGG + Intronic
1110914433 13:81003820-81003842 AATGTACTACATATGTACCGTGG - Intergenic
1111277943 13:85976261-85976283 AAATGAAAACATAAGTATCAGGG - Intergenic
1111766004 13:92530287-92530309 AATTTAGAGCATATGGATTAGGG + Intronic
1114067069 14:19069875-19069897 AATGTACTACATATACATCATGG - Intergenic
1114095196 14:19330153-19330175 AATGTACTACATATACATCATGG + Intergenic
1114774261 14:25463161-25463183 AATTTAAAAAATATATATTAAGG + Intergenic
1116157722 14:41228997-41229019 AATTTACTAGGTATTTATCATGG - Intergenic
1116429797 14:44832859-44832881 TATTTGCAAAAAATGTATCAAGG - Intergenic
1116746377 14:48824529-48824551 AATTTGGAACATATACATCATGG + Intergenic
1116880731 14:50166168-50166190 AATTTTAAGCATATGTAGCAAGG - Intronic
1118897512 14:69957540-69957562 AATGGAATACATATGTATCAAGG - Intronic
1120805560 14:88745587-88745609 AATTTGTTACATATGTATTATGG - Intronic
1122866905 14:104610300-104610322 AATTTCCAACATATGAATTTTGG - Intergenic
1123792657 15:23737914-23737936 AATTTTGAACAAATGTGTCATGG + Intergenic
1124368780 15:29091559-29091581 AATTTATAATACATTTATCATGG + Intronic
1126231887 15:46336831-46336853 AATTTGCTACATATACATCATGG + Intergenic
1127190030 15:56519458-56519480 AATTCACAGCATGGGTATCAAGG + Intergenic
1127742041 15:61918900-61918922 ATTTTTCAAGATATGTATGAAGG - Intronic
1128795116 15:70461071-70461093 AAATTACCACAAATGCATCAGGG + Intergenic
1130619900 15:85451947-85451969 AACTTAGAAAATATGTTTCAGGG - Intronic
1132371408 15:101301961-101301983 AGTTTAAAACAAATGCATCATGG + Intronic
1134780031 16:16887141-16887163 CCTGTACAACATATGTTTCATGG + Intergenic
1135694139 16:24573213-24573235 AATTTAATACTTATTTATCAGGG - Intergenic
1136691689 16:32037000-32037022 AATTTAGAATATATGCATCGTGG + Intergenic
1136792277 16:32980563-32980585 AATTTAGAATATATGCATCGTGG + Intergenic
1136877540 16:33873345-33873367 AATTTAGAATATATGCATCGTGG - Intergenic
1137703128 16:50512522-50512544 AGTTTACAACACATGTTTCTGGG - Intergenic
1138218713 16:55230010-55230032 AAATTAATACATATTTATCATGG + Intergenic
1139627784 16:68205164-68205186 AATATACAACATGATTATCAAGG - Intronic
1140573804 16:76139433-76139455 AATTTTCAACATATGAATTTTGG + Intergenic
1140625058 16:76783549-76783571 AATTTAAAAAATATGTATGGTGG - Intergenic
1140694937 16:77523548-77523570 AATGTGCCACATATGTACCATGG + Intergenic
1140893263 16:79303278-79303300 TATTAAAAACATATCTATCATGG - Intergenic
1141105216 16:81227726-81227748 AATTTAAAAAATAACTATCAAGG - Intergenic
1141120461 16:81351051-81351073 AATTTAAAATATATATTTCACGG + Intronic
1203094483 16_KI270728v1_random:1242027-1242049 AATTTAGAATATATGCATCGTGG + Intergenic
1143976422 17:10833446-10833468 TATTTACAAAATATGTATCTGGG + Intronic
1144933502 17:18879182-18879204 ATTTTAGAAGGTATGTATCACGG + Intronic
1147320282 17:39641868-39641890 AACTTACTAGACATGTATCATGG + Intronic
1149414066 17:56440063-56440085 AATATACATTATATTTATCAAGG + Intronic
1150583955 17:66500715-66500737 AATTTTCAACAAATGCACCAAGG - Intronic
1151098768 17:71531551-71531573 AATTTAAAACAGATGTACAATGG - Intergenic
1153207816 18:2722050-2722072 TATTTGCAACATGTGTAACAAGG - Intronic
1157537345 18:48469768-48469790 AATCTAGAAAATAGGTATCATGG + Intergenic
1158691180 18:59662377-59662399 AATTTACAACGTATATTACAAGG + Intronic
1158762715 18:60409582-60409604 GAGTAACAACATATGTGTCATGG + Intergenic
1159259037 18:65987530-65987552 AATTTAAAATATATGTAGAATGG - Intergenic
1159528454 18:69625109-69625131 CACTTACTACATATGTATTAAGG - Intronic
1159694969 18:71545578-71545600 ATTCTGCAACAAATGTATCAGGG - Intergenic
1160670402 19:359879-359901 GAATTACAACATATGAATCTGGG + Intergenic
1163221592 19:15925355-15925377 AAATTCCTAAATATGTATCATGG + Intronic
1164104497 19:22095858-22095880 AAATTAAAACATATGTTTCCTGG - Intergenic
925516455 2:4689041-4689063 AATTTCCAACATATGAATTTTGG + Intergenic
926768288 2:16344266-16344288 AATTCTCAACATAATTATCAGGG + Intergenic
927124921 2:20005349-20005371 AACTAAAAAAATATGTATCAGGG + Intronic
927306375 2:21578044-21578066 AATTTAGGACAAATGTATAATGG + Intergenic
927599693 2:24430201-24430223 AATTTCCAACATATGAATTTCGG - Intergenic
928529852 2:32179886-32179908 AATTTACAACAGATATATAGTGG - Intronic
929095213 2:38257273-38257295 AATTTACCAAATAAGTTTCAAGG - Intergenic
930497462 2:52164934-52164956 AATTTACAACAGCTGTTTTAAGG + Intergenic
931014493 2:57960816-57960838 AATTTATAACAAGTGTAACAGGG + Intronic
931580191 2:63763581-63763603 AATTAACAACATGTGTATTTTGG - Intronic
931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG + Intergenic
932441519 2:71739267-71739289 AATGTGGTACATATGTATCATGG - Intergenic
935680529 2:105632673-105632695 AATTTACAAAATAAGAAACACGG + Intergenic
935890574 2:107673385-107673407 AAGGTATAACATATGTATAATGG - Intergenic
936004712 2:108873924-108873946 AATTTTCTACATCTGTATAATGG - Intronic
936529613 2:113266935-113266957 AATGTACAAAATATGCATGATGG + Intronic
936627961 2:114168856-114168878 AATTTAGTATATATGAATCATGG - Intergenic
937397339 2:121548471-121548493 AACTTACAAAATATATTTCAGGG + Intronic
937962916 2:127475873-127475895 TTTTTGCAACATATTTATCAGGG - Intronic
940550457 2:155148693-155148715 ACCTTACAAAAAATGTATCAAGG - Intergenic
940603536 2:155890921-155890943 AATTGACAAAATTTATATCAAGG + Intergenic
941435745 2:165469155-165469177 AATATAAAACATAAGTATAAAGG + Intergenic
941747564 2:169103334-169103356 AATTTACAACATATAGAGTAAGG + Intergenic
942306688 2:174614970-174614992 TATTTACAGCATAAGTAACATGG + Intronic
942523938 2:176832978-176833000 AATTTAAAACATACAAATCATGG + Intergenic
943785666 2:191875864-191875886 ATTTCACAACATTTATATCAAGG - Intergenic
943926206 2:193783746-193783768 AAGTTGTAACATATGTATAATGG + Intergenic
943977727 2:194505128-194505150 AATTGACAGCACATGTTTCAGGG + Intergenic
944902282 2:204227815-204227837 AATTTAAAAAATATATATCGGGG + Intergenic
945178412 2:207066695-207066717 AATGTACTACAATTGTATCAAGG - Intergenic
945237366 2:207643800-207643822 AATTAACCACATATGCATAATGG + Intergenic
945278460 2:208012383-208012405 AATTGACAATAAATGAATCATGG - Intronic
945664649 2:212725592-212725614 AAGTTTCAACATATGAATCTGGG + Intergenic
946943219 2:224792173-224792195 AATTTATAACATATGGCTTATGG - Intronic
947509069 2:230734335-230734357 CATTTCCTAAATATGTATCATGG + Intronic
1169612229 20:7394751-7394773 ATTCTACAACATAAGTGTCAAGG - Intergenic
1169995737 20:11554229-11554251 ACTCTTCAAAATATGTATCAGGG - Intergenic
1170374768 20:15688423-15688445 TATTGACAGCAGATGTATCAGGG + Intronic
1172158536 20:32847516-32847538 AATTCACAAGATATGTCTCAAGG - Intronic
1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG + Intergenic
1175883396 20:62273423-62273445 CATTTACAAGATATTTATGATGG - Intronic
1176712998 21:10272189-10272211 CATTTAAAAAATATGTATCTTGG + Intergenic
1177240986 21:18456776-18456798 GAGTTTGAACATATGTATCAAGG - Intronic
1177423226 21:20889581-20889603 AATTTTCAACATATGAAACCTGG - Intergenic
1177718198 21:24867437-24867459 TATGTACAAAAGATGTATCAGGG - Intergenic
1180485546 22:15792459-15792481 AATGTACTACATATACATCATGG - Intergenic
1180760952 22:18205562-18205584 CATTTAAAAAATATGTATCTTGG - Intergenic
1180774717 22:18419224-18419246 CATTTAAAAAATATGTATCTTGG + Intergenic
1181070829 22:20338361-20338383 CATTTAAAAAATATGTATCTTGG + Intergenic
1181843360 22:25685078-25685100 AATTTTAAAAATATGTAGCATGG + Intronic
1184505828 22:44901491-44901513 AAGATACAACACATGTATAATGG - Intronic
1184872997 22:47252544-47252566 AGTGTAGAGCATATGTATCAAGG - Intergenic
949664605 3:6322698-6322720 AATTTAGAGCATCTGTATTAAGG + Intergenic
950231646 3:11281233-11281255 CATTTATATCATAGGTATCATGG + Intronic
950357204 3:12421677-12421699 ATTTTACAATATATTTTTCAAGG + Intronic
951403165 3:22260940-22260962 ACATTAAAACATATTTATCACGG + Intronic
951726976 3:25770797-25770819 AATGTTCAACATCTTTATCAGGG - Intronic
953041235 3:39256646-39256668 TATTTACAACATATTTATCATGG - Intergenic
955055430 3:55451017-55451039 AACTTCTAACATATTTATCAAGG + Intergenic
955075123 3:55606552-55606574 AATTTACATCATGTGGATGATGG + Intronic
955454802 3:59108208-59108230 TATTTACTAAATATGTCTCAAGG - Intergenic
955591639 3:60542089-60542111 AATTTAAAAATTATGTATAAGGG - Intronic
957669145 3:83278287-83278309 AAGTTTCAACATATGAATCTGGG - Intergenic
957807688 3:85171051-85171073 AAATTAAAACATTTGTTTCAGGG - Intronic
957918126 3:86712849-86712871 AATTCACTACATATTTATAAGGG - Intergenic
958268029 3:91462866-91462888 AAATAAAAACATGTGTATCAAGG + Intergenic
958516176 3:95118996-95119018 CATATACAACATATTTATAAAGG + Intergenic
958617399 3:96512889-96512911 AATATTCAACATGTGTATCTTGG - Intergenic
959263266 3:104106770-104106792 AATGTAATACATATATATCATGG + Intergenic
959307399 3:104687006-104687028 TATTTATAACAAATATATCAGGG - Intergenic
959315511 3:104801072-104801094 AATTTACTTCATATGCATCATGG + Intergenic
959547795 3:107617567-107617589 AGTTTTCAGCATATGTATCCTGG + Intronic
961231574 3:125317000-125317022 ACTTTACTACTTCTGTATCAAGG - Intronic
961397162 3:126602729-126602751 AAATTACAATATCTGTTTCAGGG - Intronic
963524225 3:146396039-146396061 AATTTACAAAATATGCAACATGG + Intronic
964683443 3:159367506-159367528 AAGCTACAACATATGAGTCACGG - Intronic
965112359 3:164443935-164443957 AATTTAGTACATATATACCATGG - Intergenic
965156257 3:165060899-165060921 AACTTTTTACATATGTATCATGG - Intronic
966461167 3:180178365-180178387 AAATTACAACATATTTATATTGG - Intergenic
967521661 3:190439377-190439399 AATTTACAATAGATGGAGCAGGG - Intronic
967767686 3:193299616-193299638 AGTTTACAACATAGGTCTCTTGG + Intronic
969085888 4:4656113-4656135 AAGTTTCAACATATGAATCTGGG - Intergenic
970395445 4:15660704-15660726 AATCTACAACATGTGTAAAAAGG + Intronic
970495881 4:16625522-16625544 TATTCACCAAATATGTATCAAGG - Intronic
971104629 4:23509985-23510007 AATTTACAAGATTTATTTCATGG + Intergenic
971450863 4:26800363-26800385 AATGTAGCACATATGTACCATGG - Intergenic
971823956 4:31597080-31597102 AATTTATGAAAGATGTATCATGG + Intergenic
972040607 4:34591521-34591543 AATTTGGCACATATGCATCATGG + Intergenic
972074627 4:35070577-35070599 AATTATCAACATATGTATGCAGG - Intergenic
972738589 4:41868139-41868161 AAATTAATAAATATGTATCATGG + Intergenic
973096443 4:46207133-46207155 AATATACAATATTTGGATCATGG + Intergenic
973582304 4:52356494-52356516 AATTAAGAACATATGAATCTAGG - Intergenic
974248564 4:59355678-59355700 AATTTGCAAAATATGAATCTGGG - Intergenic
974474176 4:62358657-62358679 AAATTACAACATATTTATTAAGG - Intergenic
974895519 4:67933407-67933429 AATTTACATCACATTTAACAGGG - Intronic
975330922 4:73111604-73111626 TATTTAAAAAATATGTATAAGGG + Intronic
975385361 4:73752332-73752354 TATGTACAACATATGTATTATGG - Intergenic
975559934 4:75699588-75699610 ACTTTACAAGACATGTAACAAGG - Intronic
975974939 4:80084153-80084175 AATTTCCAACATATGAATTTTGG + Intronic
976486020 4:85606058-85606080 AAATTACAACATTTATGTCATGG + Intronic
976958730 4:90939681-90939703 ATTTTATAACATATTTATAAAGG - Intronic
977346148 4:95818984-95819006 AATTTACAAAACATGTATTTTGG - Intergenic
979009455 4:115348921-115348943 AATTTTCATCAAATGTATAAGGG + Intergenic
979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG + Intronic
979580907 4:122358860-122358882 AATCTGCAACATAGGTATTAGGG - Intronic
980292654 4:130864417-130864439 TATTTATAAAATATGTATGACGG - Intergenic
980801991 4:137763433-137763455 AATATACTACATATATACCATGG - Intergenic
980847814 4:138344932-138344954 TATTTCCCACATAAGTATCAGGG - Intergenic
981059186 4:140402525-140402547 AATGTACAACTTATTTAACATGG - Intronic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
981866580 4:149427587-149427609 AAGTTACAAAAAATGTATTAGGG - Intergenic
982142411 4:152338987-152339009 AATTGACAACAGATATATTAAGG + Intronic
983155617 4:164344007-164344029 AATGTAGTACATATATATCATGG + Intronic
983309155 4:166035079-166035101 AATTTCCAACATATGAATTTTGG + Intronic
984375781 4:178927070-178927092 AAGTTTCAAGATATGAATCATGG - Intergenic
984435147 4:179700619-179700641 AATGGACGACATATGTAACATGG + Intergenic
985067289 4:186134967-186134989 AATGTATAACAGATGAATCAGGG + Intronic
986030338 5:3887501-3887523 TATTTACAACATATGTCTGCAGG + Intergenic
987098652 5:14573049-14573071 AAGTTTCAACATATGAATTACGG + Intergenic
987208506 5:15653540-15653562 AATTTACCAATTATTTATCAAGG + Intronic
988412673 5:30907351-30907373 AAGTTTCAACATATGAATCTTGG + Intergenic
989126844 5:38062623-38062645 CTTTTACAACATATGTCACATGG - Intergenic
989461577 5:41705528-41705550 GAATTACAACATATATACCAAGG - Intergenic
989461580 5:41705585-41705607 GAATTACAACATATATACCAAGG - Intergenic
990144240 5:52741149-52741171 AATTTACCTCTTATTTATCAAGG - Intergenic
991252974 5:64584325-64584347 TATTTACAAAATATGTAAAATGG + Intronic
991322843 5:65394719-65394741 GATTTACCACACATGCATCATGG - Intronic
993130196 5:83887157-83887179 AAATTTCTACTTATGTATCAGGG + Intergenic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993374231 5:87130524-87130546 AATGTGGTACATATGTATCATGG + Intergenic
993763367 5:91824595-91824617 ATTTTACCAAATATGTCTCAAGG + Intergenic
994335893 5:98566019-98566041 AATTTACATCTTAAGTAACATGG + Intergenic
994509519 5:100686350-100686372 AATTTACAAAATATTTTTAAAGG - Intergenic
994961118 5:106604171-106604193 ACTCTACAACCTATGGATCAAGG + Intergenic
995102061 5:108323909-108323931 AATTTTTAACATATGGATCAAGG - Intronic
996341330 5:122441985-122442007 AATTGACAACATATGGTTGAAGG + Intronic
997244903 5:132339214-132339236 TATTTACAACATATATACAAGGG - Intronic
997316040 5:132936853-132936875 AATACACAACATAGGTATTATGG - Intronic
998281340 5:140810283-140810305 AATGTACAATATATTTATGATGG - Intronic
999068166 5:148714655-148714677 AATTAACAGCATATGTCTCTGGG + Intergenic
999591645 5:153154938-153154960 AATTTGGAACATACATATCAAGG - Intergenic
999774206 5:154799192-154799214 TATTTACAGCATATGCATGATGG - Intronic
1000217161 5:159171265-159171287 ATTTTACAACATGAGAATCATGG + Intronic
1000500111 5:162037324-162037346 AATTTATAAAATATGTGTAAAGG - Intergenic
1000964641 5:167641339-167641361 AATTTATCACCTATATATCATGG + Intronic
1001465587 5:171962341-171962363 AAATTATAACAAATGTATCTTGG - Intronic
1004589260 6:17032658-17032680 AATTTTCAAATTATGTTTCATGG - Intergenic
1005264266 6:24094767-24094789 AATTTAGTACATATATACCATGG - Intergenic
1005679564 6:28192712-28192734 AATTAACAAAAAATGGATCATGG + Intergenic
1005794930 6:29349591-29349613 AATGTAGTACATATATATCATGG - Intergenic
1007296769 6:40829216-40829238 AATTGACTCCATATGTATCATGG + Intergenic
1007553765 6:42749176-42749198 AATTTCCAACATATATAACATGG + Intronic
1009354488 6:62725041-62725063 TATTTCTAACATATTTATCAGGG + Intergenic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1009771865 6:68153773-68153795 AATGTAGCACATATGCATCATGG - Intergenic
1010116723 6:72321217-72321239 AAACTACAACAGATATATCAAGG + Intronic
1010752109 6:79627279-79627301 AATTTACAACATATGTGACCAGG - Intergenic
1011400921 6:86960421-86960443 AATTTCCAACATATGAATTTTGG + Intronic
1012047917 6:94302076-94302098 AATATGGCACATATGTATCAAGG + Intergenic
1012217714 6:96608321-96608343 AATTTACAAAATATTTATATTGG + Intronic
1012245071 6:96917118-96917140 AATTTCCAACATAAGAATCTTGG - Intergenic
1012264291 6:97122231-97122253 AATTTACAAAATACCTATAAAGG - Intronic
1013469964 6:110454469-110454491 ACTTTAAAAAATATATATCATGG + Intronic
1014486662 6:122007534-122007556 AATTGAAAACATATGTGTCTGGG - Intergenic
1014506055 6:122258126-122258148 ACTTTTCAACATAAGTATGAAGG - Intergenic
1014935573 6:127381182-127381204 CATCTACTACATATTTATCATGG + Intergenic
1014965124 6:127738729-127738751 AATTCACCACTTATGTCTCAAGG - Intronic
1016789086 6:148048747-148048769 AATTTACCAAATTTGAATCAAGG + Intergenic
1018352167 6:162971295-162971317 CATTTACAAAATATGGATCATGG + Intronic
1019930243 7:4217864-4217886 AATTTACAAAATCTGTACCTGGG + Intronic
1020548427 7:9565816-9565838 AGTTTGCAAAATGTGTATCAAGG - Intergenic
1020780202 7:12508412-12508434 TATTTACCACATAAGCATCATGG - Intergenic
1020977604 7:15026049-15026071 AATTTAGAACATCTGTAACTAGG - Intergenic
1022055990 7:26734868-26734890 AATTTCCAACATATGAATTTTGG + Intronic
1022398283 7:30010706-30010728 AATGTACAATATATATATGATGG + Exonic
1022567699 7:31420034-31420056 AATTTAAAACATAAGAAGCAAGG - Intergenic
1022711050 7:32850652-32850674 AATTTACAAAAGAGGTATAATGG + Intergenic
1023643559 7:42285474-42285496 AATTACCAAAAAATGTATCAGGG + Intergenic
1024180993 7:46894743-46894765 AATTTAAAAAATATATATTAAGG - Intergenic
1025817365 7:64927465-64927487 AATTTTCCACAAATGTATCTTGG + Intronic
1026191383 7:68131488-68131510 AATTTACAACATCCATATCCTGG - Intergenic
1027357482 7:77372127-77372149 AATTTACAAATAATGTATAAAGG + Intronic
1027580758 7:79992116-79992138 AATTTTCAACATATAAATCCTGG - Intergenic
1027728042 7:81832070-81832092 AAGGTATAACATATGTATAATGG + Intergenic
1027793900 7:82668149-82668171 GATTTTCAACATATGAATCTGGG + Intergenic
1029874106 7:103730600-103730622 AATTTATAACAAATGTAAAAAGG + Intronic
1031459659 7:122032124-122032146 AATTTACTGCAAATTTATCATGG + Intronic
1031466624 7:122120259-122120281 AATTGAAAACTTAAGTATCAAGG - Intronic
1031938600 7:127762929-127762951 AATGTACATAATCTGTATCAGGG + Intronic
1033489739 7:141830953-141830975 AACTTATAAAATCTGTATCAGGG + Intergenic
1035908143 8:3536299-3536321 ATTTTACAACATATTTAAAATGG + Intronic
1037225969 8:16590476-16590498 AATTTGGCACATATATATCATGG + Intergenic
1040767936 8:50938376-50938398 AATGTACAACAAATGCATAATGG + Intergenic
1041387683 8:57321307-57321329 AATGTAGCACATATATATCACGG - Intergenic
1042211444 8:66385092-66385114 AATTTAGAACAAATGTATTATGG + Intergenic
1042525050 8:69756068-69756090 AATTTAAAACATATTTCACATGG - Intronic
1043126188 8:76398876-76398898 AATTAACAACATGTATTTCAAGG - Intergenic
1043131436 8:76467359-76467381 AATTTACTACATATACACCATGG - Intergenic
1043658649 8:82706296-82706318 CATTTACAGCATATGTACCCTGG + Intergenic
1043815851 8:84800109-84800131 AATTTCCAACATCTGAATCCAGG + Intronic
1046975424 8:120270566-120270588 CATTTAAAAAATATGTATCAAGG + Intronic
1047440878 8:124877300-124877322 GATTTCCAAAATACGTATCAGGG - Intergenic
1048079374 8:131108548-131108570 TATTTACAACCCATGGATCAAGG - Intergenic
1050523883 9:6528777-6528799 AATATACATAATATATATCATGG - Intergenic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1051490909 9:17663470-17663492 ATTTTACAAAAGATGTATCTGGG + Intronic
1051566451 9:18504762-18504784 ATTTTAGAACACATGTTTCAGGG + Intronic
1052516071 9:29481478-29481500 AATTTGGAACATATATACCACGG - Intergenic
1053358688 9:37467572-37467594 AATTTGATAAATATGTATCATGG + Intergenic
1055211857 9:73804787-73804809 AAGTGACAAGGTATGTATCAAGG - Intergenic
1056059153 9:82864692-82864714 CATTTCAAACATATGTATCTGGG - Intergenic
1056689537 9:88794953-88794975 TAATTCCAACATGTGTATCATGG - Intergenic
1058213960 9:102208923-102208945 AATTTTAAATATATGTATAATGG + Intergenic
1058220398 9:102292696-102292718 CATTTATCACATATGGATCAGGG + Intergenic
1058615745 9:106825595-106825617 AATTAAAAACATATTTTTCATGG - Intergenic
1059619691 9:115989780-115989802 AAGTTTCAACATATGAATCTGGG - Intergenic
1203532616 Un_GL000213v1:161224-161246 AATTTTCAAAATTTGTCTCAAGG - Intergenic
1186568478 X:10689677-10689699 AATCTACAACATTTGAAACACGG - Intronic
1187302454 X:18064281-18064303 AACCTTCAATATATGTATCATGG + Intergenic
1188801995 X:34543808-34543830 AAGTTTCAACATATGATTCAGGG + Intergenic
1188960575 X:36486648-36486670 AATTTACATCATGTCAATCAAGG - Intergenic
1189025583 X:37390279-37390301 AATTTCCAACATATGAATTTTGG + Intronic
1189096079 X:38141210-38141232 TATTTAAAACATATGTATTTAGG - Intronic
1189154703 X:38745454-38745476 TATATAATACATATGTATCAAGG + Intergenic
1191631638 X:63328415-63328437 AATTTAGTATATATGTATGATGG + Intergenic
1191797700 X:65039124-65039146 AGTTTACAACTTATATATGAAGG - Intergenic
1192010098 X:67260061-67260083 TATTGACAACATATATAGCAAGG - Intergenic
1194012525 X:88580628-88580650 AATGTACTACATATTCATCATGG + Intergenic
1194083904 X:89502469-89502491 AAGTTTCAACATATGAATTATGG - Intergenic
1195023633 X:100853840-100853862 ATTTTAAAACAAATGTTTCAAGG + Intronic
1195386656 X:104320012-104320034 AGTTTGCAACATCTGTTTCAGGG + Intergenic
1196388289 X:115183107-115183129 AATATACAGTAGATGTATCAGGG + Intronic
1198405651 X:136309937-136309959 AATTTTCAACATCTGTATGGTGG + Intronic
1198798900 X:140429782-140429804 AATGTACAATAATTGTATCAGGG - Intergenic
1199204263 X:145130005-145130027 TATATATGACATATGTATCAGGG + Intergenic
1199306569 X:146273735-146273757 AATTTCCTACATATATACCATGG - Intergenic
1199397402 X:147355381-147355403 AATGTGCTACATATATATCATGG + Intergenic
1199446575 X:147930093-147930115 AATTAACAACATTATTATCAAGG - Intronic
1200436551 Y:3158349-3158371 AAGTTTCAACATATGAATTATGG - Intergenic
1200618459 Y:5410893-5410915 AATGTGGTACATATGTATCATGG - Intronic
1202126678 Y:21574548-21574570 CATTTACACCATATGTGTCAGGG + Intergenic