ID: 1075851905

View in Genome Browser
Species Human (GRCh38)
Location 10:125595794-125595816
Sequence GCAGAGAAGTAAACAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075851905 Original CRISPR GCAGAGAAGTAAACAGGGGA AGG (reversed) Intronic
900037149 1:424084-424106 GACGAAAAGTAAAAAGGGGATGG + Intergenic
900058779 1:659825-659847 GACGAAAAGTAAAAAGGGGATGG + Intergenic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
901159157 1:7161901-7161923 GCAATGAAGAAAACAGGGCAAGG + Intronic
901257707 1:7845722-7845744 ACAGAGAAGTAAACTGAGGCAGG + Intronic
901343544 1:8517850-8517872 TCTAAGAAGTAAACAGGGAATGG + Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902174487 1:14638978-14639000 CCAGAGAGGTAAACTGAGGAAGG - Intronic
903283051 1:22261258-22261280 ACAGAGCTGTAAGCAGGGGAGGG + Intergenic
903360360 1:22773153-22773175 GCAGTGAAGTATACAGAGCAAGG + Intronic
903501759 1:23804279-23804301 GCTGAGGAGTAAAGAGGGAAAGG - Intronic
905186092 1:36197902-36197924 TCTTAGAAGAAAACAGGGGAAGG - Intergenic
905679251 1:39855681-39855703 GCAAAGAAATGAAAAGGGGAAGG + Intronic
905845017 1:41222172-41222194 GAAGAAAAGGAAACAAGGGAAGG + Intronic
907076951 1:51587667-51587689 GCAGAAAGGTAAACAGGCAAGGG - Intronic
907644853 1:56232109-56232131 GAAGAGAAGTGAAAAGGAGAGGG + Intergenic
907935744 1:59040744-59040766 CCAGAGAAGTAAAAACAGGAGGG + Intergenic
908062703 1:60369150-60369172 GCAGACTACTAGACAGGGGAGGG - Intergenic
908262435 1:62349485-62349507 GGGGAGAAGTGAAGAGGGGAAGG + Intergenic
909008520 1:70305787-70305809 ACGGATTAGTAAACAGGGGAAGG + Intronic
909873839 1:80778876-80778898 CCAGTGAAGTTAACAGGGGCAGG - Intergenic
910042447 1:82869048-82869070 GTAGAAAAGAAAACAGAGGAAGG + Intergenic
910110773 1:83680688-83680710 GCAAAGAAGTACAGAGGTGAAGG + Intergenic
912192946 1:107361978-107362000 GCAGAGACAACAACAGGGGAAGG + Intronic
912806368 1:112759874-112759896 GAAGAGAAGAGAAGAGGGGAGGG + Intergenic
914720788 1:150287159-150287181 GCAGAAAAGTAGAAAAGGGATGG + Intergenic
915043639 1:152991619-152991641 GCAGAGAAAGAAAGAGGTGAGGG - Intergenic
915323200 1:155067278-155067300 GGAGAGAAGAAAACCTGGGAGGG + Intronic
916988252 1:170214608-170214630 GCAGAAAAAAAGACAGGGGAGGG + Intergenic
917216246 1:172681055-172681077 GCAGAGAAGGCAATGGGGGATGG - Intergenic
917311895 1:173687462-173687484 TCAGAGAAGAAAAAAGGGGTGGG - Intergenic
918167823 1:181967499-181967521 TCATAGAAGTAAAGAGTGGATGG - Intergenic
918628401 1:186685109-186685131 ACAGAGAAGGAAAGAAGGGAAGG + Intergenic
918992252 1:191712219-191712241 ACAGATAAGTAAACAGGCAATGG - Intergenic
919200207 1:194347030-194347052 GCAGATAAGTTAACTAGGGAGGG + Intergenic
919500559 1:198332786-198332808 GGAGAGAAGTAAAGAGCAGAGGG - Intergenic
920227813 1:204450798-204450820 GGGGTGAAGTACACAGGGGAGGG + Intronic
920539473 1:206767283-206767305 TTAGAAAGGTAAACAGGGGAAGG - Intergenic
920654160 1:207863141-207863163 GCAGAGAAGGGAAGAGTGGAAGG - Intergenic
920714686 1:208328510-208328532 GAAGAGAAATAAAGAGGGGTAGG - Intergenic
920861066 1:209707229-209707251 GCAGAGAAGTAATGAGGGATTGG + Intronic
921227509 1:213035006-213035028 GCAGAGAAGGTCAAAGGGGAAGG + Intergenic
921834165 1:219760722-219760744 GCAGGGAAGGAAACTGGGAATGG - Intronic
922235691 1:223721027-223721049 GCAGCACAGTAAACAGGGCAGGG - Intronic
922466451 1:225848224-225848246 GCAGAGAAGGAAAGAGAGCAGGG + Intronic
1065241115 10:23706251-23706273 GCAAGGAAGTAAAAAAGGGAGGG - Intronic
1066253952 10:33660843-33660865 GCAGAGAAGAGAGCAGGGGAGGG - Intergenic
1066359186 10:34714025-34714047 AGGGAGAAGTAAACAGGAGAGGG - Intronic
1067247906 10:44561561-44561583 GCAGGGAGGTGAACAGGGCAGGG - Intergenic
1068147026 10:53084869-53084891 ACAGAAAAGTAAAAAGAGGAAGG - Intergenic
1068675351 10:59764263-59764285 GCAAAGGAGTCAACTGGGGAAGG + Intergenic
1069449226 10:68502767-68502789 GGGGAGAAGAAAAGAGGGGAGGG + Intronic
1070643535 10:78185868-78185890 GCCTAGAAGTAAACAGGAAAAGG - Intergenic
1070978479 10:80624969-80624991 GGAGAGAAGCACACAGGTGAGGG - Intronic
1072705322 10:97676859-97676881 GCAGTGATGTACACAGGGCAGGG - Intergenic
1072780675 10:98249223-98249245 GCAGAGAATGAACCTGGGGAGGG - Intronic
1072940813 10:99761987-99762009 GGAGAGAAGGAAAGAGGGAAGGG + Intergenic
1073985509 10:109203775-109203797 GCAGAAGAATCAACAGGGGAAGG + Intergenic
1074512803 10:114133198-114133220 GCAGGGAAGTAAAAAGTGAATGG + Intronic
1074552257 10:114455492-114455514 ACACAGAGGAAAACAGGGGAAGG + Intronic
1074795895 10:116943468-116943490 GCAGTGAAATAAACAGTGGAGGG - Intronic
1074967464 10:118504041-118504063 AAAGAAAAGTAAACAGAGGAAGG + Intergenic
1075021126 10:118953177-118953199 GCAGAGATGTACACTGGGGAGGG - Intergenic
1075851905 10:125595794-125595816 GCAGAGAAGTAAACAGGGGAAGG - Intronic
1075938294 10:126363537-126363559 TCAGGGAAGCAAACTGGGGAAGG - Intronic
1075970729 10:126649983-126650005 GGAGGGAGGAAAACAGGGGAGGG + Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076719721 10:132387734-132387756 GCAGAGCAGGAACCAGGGGAGGG - Intergenic
1076963876 11:62006-62028 GACGAAAAGTAAAAAGGGGATGG + Intergenic
1077902595 11:6501595-6501617 GCAGAGAAGGAGACAGAGAATGG + Intronic
1078292682 11:10029009-10029031 GAAGAGAAGTAAAAAGGCGAAGG + Intronic
1079128771 11:17735711-17735733 GCAGAGGAGGAAAGAAGGGAGGG - Exonic
1080473855 11:32571790-32571812 GCAGCGCAGGAAACAGGGGCTGG + Intergenic
1081677676 11:44980489-44980511 ACAGAGGAGAAAACAGGGGGCGG + Intergenic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082203347 11:49401054-49401076 GCAGACATGTAAACTTGGGAAGG + Intergenic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1083549010 11:63571788-63571810 GGAGAGAAGAAAAGAGGAGAGGG + Intergenic
1083701989 11:64485598-64485620 ACAGAGAGGTAAAAAGCGGAAGG + Intergenic
1083998502 11:66283799-66283821 GCAGAGCTCTAAACAGGGGCAGG + Exonic
1084279281 11:68076593-68076615 ACACAAAAGTAAACAGGGGCTGG + Intronic
1085026325 11:73238678-73238700 GCAGATGAGGAAACAGGAGAAGG + Intergenic
1086625131 11:88941459-88941481 GAAGAGAAGAGAAGAGGGGAGGG + Intronic
1086651688 11:89299039-89299061 GCAGACATGTAAACTTGGGAAGG - Intergenic
1087271323 11:96114863-96114885 GCAAAGAAATAAACAGGAGTAGG + Intronic
1087779532 11:102287755-102287777 GAAAAAAAGTAAACAGGGGCCGG - Intergenic
1088531085 11:110810370-110810392 GCAGAAAATGACACAGGGGAAGG - Intergenic
1088755951 11:112885327-112885349 GTAGAGAACTAAAAAGGGGGAGG - Intergenic
1089176751 11:116554154-116554176 GCAGACATGTAAACAGGGGATGG + Intergenic
1089460854 11:118652685-118652707 GCAGAGCAGAGAAGAGGGGAGGG + Intronic
1089475436 11:118756865-118756887 ACAGAGAATTAAACATGGAAAGG + Intronic
1090211529 11:124924062-124924084 GCAGGGAGCTAAAAAGGGGAAGG - Intronic
1090577980 11:128129645-128129667 TCAGAGAAATAAAAAGGGGCAGG + Intergenic
1091033315 11:132211077-132211099 GCAGAGAAGTATAGAGGGTAGGG + Intronic
1091530555 12:1350850-1350872 GCAGAGAAGGTCAAAGGGGAAGG + Intronic
1091796575 12:3300730-3300752 GCAGGGGAGAAAACAGGGCAAGG + Intergenic
1092247041 12:6869488-6869510 CCAGAAAAGGAAAAAGGGGAGGG + Intronic
1092514538 12:9195409-9195431 GAAAAGAAGGAAAAAGGGGAAGG - Intronic
1092893539 12:12991783-12991805 GAAGAGAAGAAAACAGGATAGGG - Intronic
1093191224 12:16077471-16077493 ACAGAGAAGTAAACAGACAAAGG + Intergenic
1094436397 12:30425100-30425122 GCAGAGAAGGAGAGAAGGGAAGG + Intergenic
1094440742 12:30473348-30473370 GGAGAGAAGGAAGCAAGGGAAGG + Intergenic
1095908954 12:47406147-47406169 ACAGACATGTAAACAGGGAAGGG - Intergenic
1096756638 12:53804957-53804979 GCTGAGAAGAAACTAGGGGAAGG - Intergenic
1097178572 12:57157854-57157876 GCAGAGAAGGAGGCAGGGGTTGG + Intronic
1097622450 12:61957217-61957239 GCTGAGAAGGAAAAAAGGGATGG - Intronic
1097703335 12:62842761-62842783 GCAAAGCAGGAAACATGGGAGGG + Intronic
1098281844 12:68870108-68870130 CCAGAGAAGTTAAGAGGGGAAGG + Intronic
1098464773 12:70774047-70774069 GCAGAGATGAAAACAGGCCACGG - Intronic
1099654210 12:85468663-85468685 GCCTAGAAGTAAAGATGGGAGGG - Intergenic
1100053152 12:90475629-90475651 GAAAAGAAATACACAGGGGAAGG - Intergenic
1100272025 12:93034946-93034968 GCAGAGAATCAAACAGAGAAGGG + Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101300717 12:103477382-103477404 ACAGTAAAGTAAGCAGGGGAAGG + Intronic
1102782830 12:115580205-115580227 GCAGAAAAGTAAAGCAGGGAAGG - Intergenic
1104088008 12:125493542-125493564 GCAGGGAAGAAAAGAGAGGAAGG - Intronic
1104382066 12:128315819-128315841 GCAGTGAAGAAAACAGAGGCTGG + Intronic
1104678265 12:130730266-130730288 GCAGAGAAGGAACCCGGGAAGGG + Intergenic
1104988366 12:132610404-132610426 GCAGAGAAGTACCCAGAGCAGGG + Intronic
1105241566 13:18613356-18613378 GCAGAGACGAGAACAGGGAAAGG - Intergenic
1105604542 13:21916084-21916106 GAAGAAAATTAAACAAGGGATGG - Intergenic
1106289449 13:28347176-28347198 GCAGAGATGAAGGCAGGGGAGGG + Intronic
1106511619 13:30418148-30418170 GCAGAGAAGAAAGCTGGAGAAGG + Intergenic
1107447538 13:40482056-40482078 GCTAAAAGGTAAACAGGGGAGGG - Intergenic
1107680165 13:42839774-42839796 GCAGAGAAATGAACTGGGGGTGG + Intergenic
1108261110 13:48657535-48657557 GGAGAGAGGAAAAGAGGGGAAGG + Intronic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109300707 13:60587237-60587259 GCAGAGAAGGAAAGAAGAGAAGG + Intergenic
1110072269 13:71191852-71191874 GCAGAGAAGGAGACAAGAGAAGG - Intergenic
1110688671 13:78405445-78405467 GGAGAGAAGTAAAAAGGACATGG + Intergenic
1110954801 13:81540737-81540759 GCAGAGAAGAACAAAAGGGAGGG - Intergenic
1111306090 13:86414744-86414766 GGAGAGAAGTGAAGAGGGGACGG - Intergenic
1112064612 13:95780140-95780162 GCAGAGAAGTAGAGAGGGCAGGG - Intronic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112365952 13:98755631-98755653 GCAGTGAAGAAAGCCGGGGAAGG - Intergenic
1112630700 13:101158452-101158474 GCAGAGAAGGAGAAAGGGGTGGG + Intronic
1113003361 13:105670228-105670250 GCAGACAAGGCAATAGGGGAAGG - Intergenic
1114982621 14:28184800-28184822 GCTGAGAAGAAAAGAGGGGAGGG + Intergenic
1115360443 14:32494397-32494419 GCAAAAAAATAAACAGTGGAAGG - Intronic
1115788684 14:36855432-36855454 GCAGAAAATTAAGGAGGGGAGGG + Intronic
1116160583 14:41262805-41262827 GCAGACTACTAGACAGGGGAGGG - Intergenic
1116201319 14:41801589-41801611 GTAGAGAAGTAAACAGGCATAGG - Intronic
1116810943 14:49539639-49539661 GGAGAGAAGGAAACAGAGTAAGG - Intergenic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1120024764 14:79570448-79570470 GGATAGAAGTGAAAAGGGGAAGG - Intronic
1121382667 14:93487689-93487711 GCAGAGAGGTTAACATGGGCAGG - Exonic
1121610303 14:95274154-95274176 GCAAAGAAAGTAACAGGGGAAGG - Intronic
1122349852 14:101082823-101082845 GCTCATAAGTAAAGAGGGGATGG - Intergenic
1122363875 14:101183125-101183147 GCAGGGAGGGAAAGAGGGGAAGG - Intergenic
1122387519 14:101359216-101359238 GCAGAGAAGAGAACAAGAGATGG + Intergenic
1123830827 15:24135648-24135670 GCAGAAAAGAAAACAGAGGAAGG + Intergenic
1124845520 15:33285952-33285974 GCAGAGGAATAGACAGGAGAAGG - Intergenic
1125095774 15:35849662-35849684 GCAGAGAAGTAAGACAGGGAGGG + Intergenic
1125178422 15:36852571-36852593 GGAGAGGAGAAAAAAGGGGAGGG + Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125884486 15:43218524-43218546 GCAGAGGACTAAGCAGGTGATGG - Intronic
1126088352 15:45029791-45029813 GCAGAGAAGGGAACTGGAGAGGG + Intronic
1126584089 15:50266092-50266114 GCTGATAAGGAAACAGGGGCAGG - Intergenic
1126658103 15:51002538-51002560 GCAATGCAGTAAGCAGGGGATGG - Exonic
1126692375 15:51297642-51297664 GCAGGGAGGGAGACAGGGGAGGG - Intronic
1127006341 15:54574569-54574591 TCAGAGAAGGAAACAGAGGATGG - Intronic
1128871255 15:71156946-71156968 GCAGCAGAGTAAGCAGGGGAGGG - Intronic
1129264788 15:74387769-74387791 GCTGAGATGTAAGCAGGGTAGGG + Intergenic
1129521505 15:76189336-76189358 GCAGAGAAAGAAGGAGGGGAGGG + Intronic
1129714049 15:77836758-77836780 GCAGAGAACTATCCAGTGGAGGG + Intergenic
1130355453 15:83125907-83125929 GAAGAGAAGTAAAGAAGGCAAGG + Intronic
1132444675 15:101903170-101903192 GACGAAAAGTAAAAAGGGGATGG - Intergenic
1132569722 16:638761-638783 GCAGAGAAGGCAGCTGGGGATGG + Intronic
1132633061 16:929075-929097 GCTGAGATGTGACCAGGGGAAGG - Intronic
1133318930 16:4901102-4901124 GCAGAGAAGCAATAAGGAGAGGG + Intronic
1135246360 16:20860677-20860699 GCAGAGCGGGAAACAGGGCAGGG - Intronic
1135424961 16:22327931-22327953 GGAGAGAAGGGGACAGGGGAGGG - Intronic
1135881607 16:26263175-26263197 GCAGAGAAGATCAAAGGGGAAGG + Intergenic
1136039406 16:27566174-27566196 GGAGTGAGGTAAACAGAGGAAGG - Intronic
1136267193 16:29128733-29128755 GCAAAAAAGTTAACAGTGGAGGG + Intergenic
1136609017 16:31355151-31355173 GCAGAGAGGTGGCCAGGGGAAGG - Intronic
1137926889 16:52548116-52548138 GCAGATAACTAAACTGGGGAGGG - Intergenic
1137934323 16:52619616-52619638 GGAGTGAAGTAAGCAGGGGATGG + Intergenic
1138941378 16:61794586-61794608 ACAGAGAAGTAAACAGTGAAAGG - Intronic
1138948664 16:61883936-61883958 GCAGAACAGTAAACAGTAGAAGG + Intronic
1139004238 16:62551437-62551459 GAAGAGAATAAAAAAGGGGAGGG - Intergenic
1139413904 16:66790252-66790274 GAAGGGAAGGAAAAAGGGGAGGG + Intronic
1140447711 16:75044682-75044704 GCAGAGAAGTCAACAGGATGAGG - Intronic
1140703306 16:77602686-77602708 GCAGAGAAGGAAATAGAGGATGG + Intergenic
1141844536 16:86598339-86598361 GAAGAAAAGAAAACAGAGGAAGG - Intergenic
1142070485 16:88089056-88089078 GCAAAAAAGTTAACAGTGGAGGG + Intronic
1142429259 16:90017767-90017789 GCAGACAAGGAAACAGGAGTTGG + Intronic
1143091297 17:4450395-4450417 GAAGAGAAGTAAGGAAGGGAGGG - Intronic
1143714228 17:8755669-8755691 GGAGAGAAGGGAACAGGGGCTGG + Intronic
1144761724 17:17710999-17711021 GGAGAGAAGGGAGCAGGGGAGGG - Intronic
1144867636 17:18347120-18347142 GCAGAGATGTCACCAGGCGAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1148904068 17:50900468-50900490 GGAGAGGAGTAAAGAGGTGAAGG + Intergenic
1149102963 17:52928127-52928149 GCAGAGAAGGAAAGAAGAGAAGG - Intergenic
1149213209 17:54326944-54326966 TCAGAGCAGTGAACAGGGGCTGG + Intergenic
1151196746 17:72437193-72437215 GCAGAGAGGCAAAGCGGGGAAGG - Intergenic
1151446115 17:74165221-74165243 GCAGAGAAATCAATAGGTGACGG - Intergenic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152873268 17:82770630-82770652 ACAGACAAGTAAACAAGGGTGGG - Intronic
1154447392 18:14446550-14446572 GCAGAGACGAGAACAGGGAAAGG + Intergenic
1155380874 18:25220550-25220572 ACAGACAAGAAAACAGGGGCGGG - Intronic
1155694862 18:28673355-28673377 GCAAAGAAGAAAAAATGGGAAGG - Intergenic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157357340 18:46947818-46947840 GGAGAGAAATAAACAGAGGCTGG - Intronic
1157592094 18:48842179-48842201 GAAGAGAAACAACCAGGGGATGG + Intronic
1158005055 18:52662636-52662658 GAAAAGAAGAAAACAAGGGATGG + Intronic
1158354142 18:56597569-56597591 GTAGAGTAGTAAACAGGAAAGGG - Exonic
1158757985 18:60349604-60349626 GCAGTGAAGTAAAGAGGGGTGGG - Intergenic
1158998521 18:62948467-62948489 AGAGAGAAGACAACAGGGGAAGG - Intronic
1159731172 18:72030979-72031001 GCAGAGAAAAAAATAGGGGTAGG - Intergenic
1160379914 18:78446362-78446384 GCAGGCAAGTAAAGAGGTGATGG + Intergenic
1160602266 18:80022767-80022789 GAAGAGAAGGAAAGAGGAGAAGG - Intronic
1160640679 19:131638-131660 GACGAAAAGTAAAAAGGGGATGG + Intergenic
1161560763 19:4971354-4971376 GGAGAGAAGGACACAGAGGACGG - Intronic
1161750860 19:6095595-6095617 GCAGAGGTGTAAACAAGGGGAGG + Intronic
1162204563 19:9046105-9046127 GGAGAGAAGGAATCTGGGGAGGG - Intergenic
1163009660 19:14417136-14417158 AAAGAGAAGTAACCAGGGTAGGG + Intronic
1165087257 19:33359225-33359247 AGAGAGAAGTAAACAGTGTAAGG - Intergenic
1165446385 19:35858941-35858963 GAAGAGAAGAAGACATGGGAGGG + Intronic
1167486530 19:49766487-49766509 GTAGAGAAGGAAAGAGGGGAGGG - Intergenic
1167563060 19:50238069-50238091 GCAGAGATGTAAAATGGGGAAGG - Intronic
1167581023 19:50342875-50342897 GAAGAGAAGAGAAGAGGGGAAGG + Intronic
1167854422 19:52226289-52226311 GTGGAGAAGTAAATGGGGGAGGG - Exonic
1168162263 19:54519211-54519233 CCAGAGAGGAAAAGAGGGGAAGG + Intergenic
1168509289 19:56961595-56961617 GGAGAGAAGAGAAGAGGGGAGGG - Intergenic
926236621 2:11050295-11050317 ACACAGAAGGAAACAGGGGTAGG - Intergenic
927019856 2:19005203-19005225 GCAGAGCAGTGCACGGGGGAGGG - Intergenic
927973029 2:27317570-27317592 GCAGAGAAGGAAACTGAGGCAGG - Intronic
930267685 2:49219085-49219107 GCAGGGAAGAAAACTGGGGGTGG + Intergenic
930665877 2:54097935-54097957 GGAGAGAAAGAAACAAGGGAAGG - Intronic
930849028 2:55937855-55937877 CCAGAGAAATAAACTGGGGTTGG + Intergenic
931201634 2:60103289-60103311 GGAGAGAAGTGAAGAGGGGATGG + Intergenic
931465123 2:62479251-62479273 TCATAGAAGTAAAAAGTGGAAGG - Intergenic
931483861 2:62670802-62670824 GCAGACAAATAATCAGGAGAGGG + Intergenic
931915119 2:66946056-66946078 GCAGAGATCTAAACTGGTGAAGG + Intergenic
932327671 2:70873816-70873838 GCACAGAACTATCCAGGGGACGG - Intergenic
932886212 2:75551506-75551528 CCAGTGAAGTCAACAGGGAAGGG - Intronic
933539708 2:83623459-83623481 GTAGAGAATTACACAGGGAATGG + Intergenic
933641441 2:84765253-84765275 AGAGAGAAGTAAACAAGGAAAGG + Intronic
933936592 2:87208981-87209003 GAAGAGAAGAGAAGAGGGGAGGG - Intergenic
934164060 2:89278264-89278286 TCAGAGCAGCACACAGGGGAAGG - Intergenic
934203214 2:89904260-89904282 TCAGAGCAGCACACAGGGGAAGG + Intergenic
935164080 2:100554595-100554617 TCAGAGAAATAGAGAGGGGAGGG + Intergenic
935331057 2:101978474-101978496 GCCCAGATGTAAACAGTGGAGGG + Intergenic
935844907 2:107155257-107155279 GCTGAGAAGTAATCCTGGGATGG - Intergenic
936356552 2:111756847-111756869 GAAGAGAAGAGAAGAGGGGAGGG + Intergenic
936832215 2:116660750-116660772 GCAGCGAAGTAATCAGGGATTGG - Intergenic
937072314 2:119073485-119073507 GGAGAGAAGGAAAAAAGGGAGGG + Intergenic
937238181 2:120443038-120443060 GGAGAGCAGGAAACTGGGGAGGG + Intergenic
937246513 2:120497432-120497454 GCAGAGAATTACACTGGGGGAGG - Intergenic
938617780 2:133017728-133017750 GGAGAGAAGGAAACAGTGGGGGG - Intronic
939026052 2:137014911-137014933 GTAGGGAAGGACACAGGGGAGGG - Intronic
940799314 2:158115872-158115894 GCAGAGAGACAAACATGGGAAGG - Intronic
942389488 2:175477288-175477310 GCAGAGAATCAACCAGGGGTAGG - Intergenic
943874210 2:193041746-193041768 GCAGAGAAGTCAAGAGGAAAAGG - Intergenic
946033554 2:216724126-216724148 GCAGAGAAGTAGCCAGGAGCTGG + Intergenic
946062385 2:216955040-216955062 GAGGAGCAGTAAACATGGGAAGG - Intergenic
946077493 2:217086643-217086665 GCTAAGAACTAAACTGGGGAAGG + Intergenic
946414641 2:219533706-219533728 GCAGGGCAGAGAACAGGGGAGGG + Intronic
947774651 2:232697768-232697790 GCGGAGAAGCAAGCAGAGGAAGG - Intronic
948411357 2:237764076-237764098 GCAGAGAAGATACCAGAGGAGGG + Exonic
948799099 2:240422853-240422875 TCACATAAGTGAACAGGGGAAGG + Intergenic
1168770194 20:409423-409445 GCAGGGAAATAAACAGGTTAAGG - Intronic
1168952253 20:1810473-1810495 GCAGGGAAGGAGACGGGGGAGGG - Intergenic
1168952480 20:1811819-1811841 GCAGAGAAGCACACAGGAGCTGG + Intergenic
1168980199 20:1997386-1997408 ACAGAGAAGGAAACAGAGGCTGG + Intergenic
1169520973 20:6372684-6372706 GGAGTGAGGGAAACAGGGGAGGG - Intergenic
1170537558 20:17356502-17356524 GCAGTGCAGTAAGGAGGGGAAGG + Intronic
1170582327 20:17708628-17708650 GCAGTGAAGAAAACAGTGCAAGG - Intronic
1170873434 20:20229474-20229496 GCTGAGAGGTAAGCAGGAGATGG + Intronic
1172354188 20:34268336-34268358 GCAGCGAAGTTAACAGGGGTCGG + Intronic
1174108253 20:48178620-48178642 GCAGAGAAGATAATAGTGGACGG - Intergenic
1174168780 20:48603657-48603679 GCAGAGGAGGAGACAAGGGAAGG + Intergenic
1175086441 20:56463087-56463109 ACAGAAAATTAAAAAGGGGAGGG + Intergenic
1175142990 20:56874307-56874329 GGAGAGAAGGAAGCAGGAGAGGG + Intergenic
1175394386 20:58649012-58649034 CCAGAGAAGTAGACAGGGCGCGG + Intergenic
1176407704 21:6430446-6430468 GGAAAGGAGAAAACAGGGGATGG - Intergenic
1176448802 21:6844119-6844141 GCAGAGATGAGAACAGGGAAAGG - Intergenic
1176826972 21:13709142-13709164 GCAGAGATGAGAACAGGGAAAGG - Intergenic
1178120674 21:29466979-29467001 GCAGAAAAGTAGAAAGGGGAGGG + Intronic
1178164891 21:29962237-29962259 GCAGAGAAGGAGAGAAGGGAAGG - Intergenic
1178924323 21:36762337-36762359 GCAGAGAAGAGAGCAGGGGTAGG + Intronic
1178931674 21:36824437-36824459 TCAGAGAAGGGAAAAGGGGAGGG + Intronic
1180136123 21:45863135-45863157 ACAAAGAAGAAAACAGGGAAAGG + Intronic
1180207967 21:46274075-46274097 GCAGAGATGTACACAGGACAAGG + Intronic
1180941778 22:19664147-19664169 GGAGAAAAGAAAGCAGGGGAGGG - Intergenic
1180965590 22:19786568-19786590 ACAGGGACATAAACAGGGGAAGG + Exonic
1181275063 22:21682995-21683017 GCAGGGCAGCAAACAGGGGCAGG - Intronic
1181975147 22:26723477-26723499 GAAGGGGAGTAAAGAGGGGAGGG + Intergenic
1182212823 22:28690811-28690833 GCAAGGAAGGAAAAAGGGGAGGG + Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183079974 22:35450070-35450092 GCTGAGAAGGAGACAGGGAAGGG + Intergenic
1184080672 22:42217414-42217436 GCAGGGGATAAAACAGGGGAGGG - Intronic
1184313452 22:43664167-43664189 GCAGAGAAGAGCACAGGGGTTGG + Intronic
1184681934 22:46077062-46077084 TCAGAGAAGGGACCAGGGGATGG - Intronic
1184817736 22:46884856-46884878 GCAGCGAAGTAAAAGTGGGAGGG + Intronic
1185230431 22:49677395-49677417 GCAGGGAAGTGAACAGGGAAGGG + Intergenic
949194086 3:1284764-1284786 GCAGAGAACTAAAGAAGTGAGGG + Intronic
949423704 3:3893273-3893295 GCAGAGAAGTAAAAATGTGGGGG + Intronic
949779862 3:7674088-7674110 GCAGAGCAGTGAGCAGAGGAAGG + Intronic
950542208 3:13619383-13619405 GCAGGGAAAAAAGCAGGGGAAGG - Intronic
951084005 3:18489381-18489403 GCACAGAAACAAATAGGGGAAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951657418 3:25025340-25025362 GCAGACAAGTCAAAAGGAGAAGG - Intergenic
952229022 3:31409973-31409995 GCAGAGAAGAAAAGAAGGCAGGG + Intergenic
952238074 3:31500925-31500947 GCAGAGAGGAAACCAAGGGATGG - Intergenic
953006622 3:38984979-38985001 GCAGAGATGTAGGCAGGGGCTGG + Intergenic
954111697 3:48437178-48437200 GCAGAGAAGGTAGCTGGGGAGGG - Intronic
954176867 3:48851687-48851709 GAAGAGAAGTACACAGGAGGAGG + Intergenic
954454903 3:50592561-50592583 GTAGGGAAGTAAACAGGAGGTGG - Intergenic
955215892 3:56984816-56984838 GAGGAAAAGAAAACAGGGGAGGG + Intronic
955498365 3:59560233-59560255 GCAGAAAACTCAACTGGGGAAGG + Intergenic
955823435 3:62920716-62920738 GGAGAGAAAGAAGCAGGGGATGG + Intergenic
955910950 3:63859694-63859716 GCAGTGAACTAGACAGAGGAGGG - Intronic
956059531 3:65335637-65335659 GCAGAGAACTCAACAGGGCAGGG + Intergenic
956308209 3:67849861-67849883 GCAGAGCATTAAACAAGGTATGG - Intergenic
956501892 3:69895959-69895981 GGAGGGAGGTAAATAGGGGAAGG - Intronic
957366436 3:79230443-79230465 CCAGAGGAGTCAACATGGGAGGG - Intronic
957507748 3:81146190-81146212 GCAAAGGAGTAAACAGGTGTAGG - Intergenic
958773571 3:98455064-98455086 GAAGAGAAGTTACCAGGGAAGGG - Intergenic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
959623241 3:108421689-108421711 GAAGAGAGGTAAGAAGGGGAAGG + Intronic
961928867 3:130512375-130512397 GTAGAGAAGTAAGCAGAGGCAGG - Intergenic
962057619 3:131888634-131888656 GCACAGAAGCAAAGATGGGAAGG + Intronic
962120557 3:132556090-132556112 TGAGAGAAGTGAACAGAGGAGGG + Intergenic
962143990 3:132820931-132820953 GAAGAGAAGTGAACAGGATAGGG - Intergenic
962391282 3:134974911-134974933 GCAGAGAAGGAAGAAGGGCAGGG - Intronic
962501589 3:135999703-135999725 GCTGAGAAAGAAAAAGGGGATGG - Intronic
963292873 3:143511193-143511215 ACAGTCAAGTAAAGAGGGGAAGG + Intronic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964273226 3:154980795-154980817 GGAGAGAAGGAAACAGGCAAAGG + Intergenic
965491246 3:169339155-169339177 ACAGATAATAAAACAGGGGAGGG - Intronic
966371848 3:179259061-179259083 GCAGAGAAGATACCAGAGGAGGG - Intronic
967193783 3:187009076-187009098 GCAAAGAAGAAAAGAAGGGAGGG - Intronic
968708471 4:2095224-2095246 GAAGGGAAGCAAAAAGGGGAGGG + Intronic
968808962 4:2791693-2791715 TCAGAGAGGTTAACTGGGGAGGG - Intergenic
969133004 4:5005443-5005465 GCAGAGAAGGGAGGAGGGGATGG - Intergenic
969570228 4:8004054-8004076 CCAGAGGAGTAAAAAGGGAAAGG + Intronic
969598116 4:8160199-8160221 GGAGAGAAGGATAGAGGGGAGGG + Intergenic
971926530 4:33016413-33016435 GAAGAGAAGGAAACAAGGGAAGG + Intergenic
971997894 4:33990479-33990501 GCAGAGAGGGAAACAAGGAAAGG + Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973097361 4:46218926-46218948 GGAGAGAAGGAAAAAAGGGAGGG - Intergenic
973302518 4:48604031-48604053 GAAGAAATGTAAACAGGGTAGGG - Intronic
974822495 4:67085050-67085072 GTCCAGAAGTCAACAGGGGATGG + Intergenic
975397696 4:73896078-73896100 GAAGAGAAGAAAACAGGGCTTGG + Intergenic
975453097 4:74553084-74553106 GCAAAGAAATAAGAAGGGGATGG + Intergenic
976620895 4:87126288-87126310 GCAGAGAAGAGTAGAGGGGAAGG + Exonic
977045413 4:92062915-92062937 GCTGAGAACAAAATAGGGGAAGG + Intergenic
977861680 4:101968582-101968604 GCAGACAAGTAAGAAGGTGATGG + Intronic
979193786 4:117895732-117895754 GCAAAGAAGTGAAAGGGGGAAGG + Intergenic
979792304 4:124800571-124800593 GCTGAGAAGGTAACAGGGGGGGG - Intergenic
980815059 4:137935178-137935200 GCAGAGAACTGAGCATGGGAAGG + Intergenic
980816836 4:137958783-137958805 GGAGAGAAGGAGACAGGTGATGG - Intergenic
981660183 4:147157710-147157732 GAAGAGAAGAAATCAGGAGAAGG + Intergenic
981817094 4:148843091-148843113 GAGGAGAAGGAAGCAGGGGAGGG - Intergenic
982018962 4:151184647-151184669 GCAGGGAAGCAATCAGTGGAGGG - Intronic
982523825 4:156452920-156452942 GCAGTGAAGAAAACAGGCCAGGG - Intergenic
982775039 4:159432536-159432558 CCAGAGAATTAAATAGGGGCTGG - Intergenic
983575412 4:169256230-169256252 GCAGAGAAGGAAGAAAGGGAGGG + Intronic
984048464 4:174833289-174833311 GGGGAGGAGTAAACTGGGGAAGG - Intronic
984129261 4:175852709-175852731 GCAGAGTATTAAACAAAGGAGGG - Intronic
984183074 4:176508929-176508951 GCAGAGAAGGGGACAGGGCAGGG + Intergenic
985104190 4:186485417-186485439 GGAGAAAAGAAAAGAGGGGAGGG - Intronic
986598595 5:9448846-9448868 ACAGAGAAGTAAACAATGGAGGG - Intronic
986693671 5:10333695-10333717 GGAGAGAAGGAAACAGGAGTGGG + Intergenic
986952434 5:13105809-13105831 GCAGAGAAGTAGAAACTGGAAGG + Intergenic
987063311 5:14262956-14262978 GAAGAGAAGAAAGCAGGGGTGGG - Intronic
987101175 5:14592355-14592377 GAAGAGAATTACTCAGGGGAAGG + Intronic
989002226 5:36773462-36773484 GAAGAGAAGTACACATGGGGAGG + Intergenic
989735074 5:44694038-44694060 GCAGAGAAGGAAAGAAGAGAAGG + Intergenic
990430758 5:55733201-55733223 GAAGAGAAGGAAAGAGGGAAAGG - Intronic
990457830 5:56005169-56005191 GGAGAGGAGAGAACAGGGGAGGG - Intergenic
991006214 5:61830630-61830652 CCAGAGAAGTAACCAAAGGAGGG + Intergenic
991078596 5:62569596-62569618 GCAGTGAAGTAACAAGGGGAGGG + Intronic
991134896 5:63170193-63170215 GCTGAGAAGTCAACAAGGGAAGG + Intergenic
991513528 5:67407485-67407507 GAAGAGAAGAGAAGAGGGGAGGG - Intergenic
991778291 5:70107122-70107144 GAAGAGAAGTTATCAGGGGCTGG + Intergenic
991857581 5:70982588-70982610 GAAGAGAAGTTATCAGGGGCTGG + Intronic
991870739 5:71107467-71107489 GAAGAGAAGTTATCAGGGGCTGG + Intergenic
992067126 5:73119311-73119333 TCAGAGAGGTAAAGAGGGGAGGG - Intergenic
992295092 5:75319628-75319650 GCTGAGAAGTAAACTAGGGCTGG - Intergenic
992840253 5:80682848-80682870 GCTGAGAAGGGAACTGGGGATGG - Intronic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
995177955 5:109199973-109199995 GCAGTGAAGCAAAGAGGGGTAGG - Intergenic
995843661 5:116469348-116469370 ACAGATAAGAGAACAGGGGAAGG + Intronic
996710136 5:126535619-126535641 GCAGAGAAGGAGAGAAGGGAAGG - Intergenic
996836867 5:127803405-127803427 GCGGATAAGTAATCATGGGAGGG - Intergenic
997935015 5:138102891-138102913 ACACAGAAGTAAACAGAGGTGGG - Intergenic
998926371 5:147130584-147130606 GCTGAGAAGTAAGCAAGGCATGG - Intergenic
999439574 5:151591039-151591061 GTAGAGAAGGAAGCAGGAGATGG - Intergenic
999448942 5:151664238-151664260 GCAGGGAAGGAGGCAGGGGAGGG + Intronic
1000823118 5:166009987-166010009 GCAGAGAGGTAAAAAGGGAATGG - Intergenic
1001010706 5:168095313-168095335 GCAGGGTAGCAAACAAGGGAGGG - Intronic
1001529606 5:172453249-172453271 GCAGAGAAGTTAACCAGGAAGGG - Intronic
1001620552 5:173081435-173081457 GCACTGAAACAAACAGGGGAGGG - Intronic
1001741565 5:174057181-174057203 GAAGAAAAGTAGAGAGGGGAGGG - Intronic
1001854940 5:175002986-175003008 GAACAGAAGTCAATAGGGGAGGG - Intergenic
1001906853 5:175479882-175479904 GCAGATCAGTAAAAGGGGGATGG - Intronic
1002736672 5:181394782-181394804 GACGAAAAGTAAAAAGGGGATGG - Intergenic
1002748027 6:80041-80063 GACGAAAAGTAAAAAGGGGATGG + Intergenic
1003427956 6:6009747-6009769 GAAGAGCAGTGAACAGGGGCAGG + Intergenic
1003491750 6:6628292-6628314 GGAGAGAAGGAAGAAGGGGAGGG - Intronic
1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG + Intergenic
1003779377 6:9405823-9405845 TCAGAGCATTAAACAGGTGATGG - Intergenic
1005017338 6:21386707-21386729 TCAGAGAAGGACACAGGGCATGG + Intergenic
1005574599 6:27179692-27179714 GCGGAGAGGTAGGCAGGGGAAGG - Intergenic
1005955209 6:30658868-30658890 GCTGAGAAGTCATCAGAGGAAGG - Intronic
1007698076 6:43746612-43746634 GCAGAGAAATGAAGAGGGGATGG - Intergenic
1008974391 6:57407936-57407958 GCAGAGAGGGAAACTTGGGAAGG + Intronic
1009163280 6:60309455-60309477 GCAGAGAGGGAAACTTGGGAAGG + Intergenic
1010077865 6:71821747-71821769 GCTCAGAAGTAAACAGCAGATGG - Intergenic
1010121643 6:72382646-72382668 CCAGAGAAGTAAACACTGGAGGG - Intronic
1010450096 6:75992727-75992749 GCTGAGAAATAAGTAGGGGAAGG - Intronic
1011193884 6:84763381-84763403 GCAGAGAAATCAAGAGGAGAAGG + Intronic
1012619285 6:101320593-101320615 GAACAGAAGTTAACAGAGGATGG - Intergenic
1014239475 6:118999138-118999160 GCTGAGCAGTAAACAGTGAACGG + Intronic
1017619390 6:156280271-156280293 GCTGAGCATTAAAAAGGGGATGG - Intergenic
1017624313 6:156332669-156332691 TCAGAGAAAAAAGCAGGGGATGG - Intergenic
1018955782 6:168409667-168409689 GCAGACAGGTACACAGGGGAAGG + Intergenic
1019241770 6:170670311-170670333 GACGAAAAGTAAAAAGGGGATGG - Intergenic
1019266282 7:119205-119227 GCAGAGAAGAAATCAGGTGGGGG + Intergenic
1019288853 7:237286-237308 TCAGAGGAGTAGGCAGGGGAAGG + Intronic
1019885484 7:3900740-3900762 GCAAAGAGGGAAAGAGGGGAGGG - Intronic
1019892295 7:3956085-3956107 GCAGCCAACAAAACAGGGGATGG - Intronic
1019919996 7:4157376-4157398 GGAGAGAAGGAATGAGGGGAGGG + Intronic
1021729040 7:23578431-23578453 GTAGAAAAGAAAATAGGGGAAGG + Intergenic
1022061345 7:26799011-26799033 GAAGGGAAGGAAAAAGGGGAGGG + Intronic
1022093342 7:27122645-27122667 GCAGACAAATAAACAGCAGAAGG + Intronic
1022172658 7:27844637-27844659 GCAAAGAAGCAAAAAGGGTAGGG + Intronic
1023653473 7:42394990-42395012 GCATAAAAGAAGACAGGGGAAGG + Intergenic
1023935910 7:44739552-44739574 ACAGAGTAGTGAAGAGGGGAGGG - Intergenic
1024233154 7:47378065-47378087 GCAGAGAAGCAACCTGGAGAAGG + Intronic
1024779776 7:52834462-52834484 GGAGATTAGTAAACAAGGGAAGG - Intergenic
1025838425 7:65119425-65119447 GAAGAAAAGTAAAAAGAGGAGGG - Intergenic
1025878852 7:65513671-65513693 GAAGAAAAGTAAAAAGAGGAGGG + Intergenic
1025884647 7:65576556-65576578 GAAGAAAAGTAAAAAGAGGAGGG + Intergenic
1026155697 7:67823730-67823752 GCAGGGAAGACAAAAGGGGAGGG + Intergenic
1026823064 7:73562638-73562660 GGAGAGAAATAAATAGGGGAAGG - Intergenic
1027499293 7:78928068-78928090 CCAGAAAAGTCCACAGGGGAAGG - Intronic
1028888722 7:95963040-95963062 GCAAAGATGTAAACAGTGAATGG - Intronic
1029212791 7:98922504-98922526 GCAGAAAAGTCAGCAGGGCAGGG - Intronic
1030195399 7:106847872-106847894 GCAGAGAAGTAGACAAGACAAGG - Intergenic
1030313523 7:108091690-108091712 GCAAAGAAGTAGCCAGGGGCTGG + Exonic
1030339443 7:108360272-108360294 GCAGAGATTTTAACTGGGGAGGG - Intronic
1030524589 7:110637686-110637708 GCAGGGAAGGAAAAGGGGGAAGG + Intergenic
1030539643 7:110814188-110814210 CCAGAGAGGAAAACTGGGGATGG - Intronic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1031775336 7:125902020-125902042 GAAGAGAAGTAAAGAAGGGTAGG + Intergenic
1031906947 7:127471001-127471023 GCAGAGAGGGAAACTGGAGAAGG - Intergenic
1032320875 7:130885588-130885610 GCTGAGAAGTACAGATGGGAAGG + Intergenic
1032478053 7:132225757-132225779 GCAGAGAAGGGAACTGAGGAGGG - Intronic
1032661624 7:133990275-133990297 GCTGAGAAATAAAAAGGGGTGGG - Intronic
1033362826 7:140650086-140650108 ACAGAGAAGTTAACAGGGCCTGG + Intronic
1033629301 7:143141064-143141086 GCAGAGAAGGAGAGAAGGGAAGG - Intergenic
1033881320 7:145887273-145887295 GCAGAGAAGGAGAGAGGAGAAGG - Intergenic
1034081426 7:148281103-148281125 GCAGGAAAGTAAAGAGGGAATGG - Intronic
1035506346 8:137785-137807 GACGAAAAGTAAAAAGGGGATGG + Intergenic
1035630706 8:1104738-1104760 GCACAGGAGCAAACTGGGGAAGG - Intergenic
1036597580 8:10228015-10228037 GCAAAGAAGAGAGCAGGGGAGGG - Intronic
1037934687 8:22907602-22907624 TCAGAGAAGTGAAGAGGTGATGG + Intronic
1038262757 8:26011631-26011653 ACACATAAGTAAACATGGGATGG + Intronic
1038331062 8:26609781-26609803 GCAGAGAAGTAATGAGTGGCAGG - Intronic
1038996629 8:32930289-32930311 CCAGAGAAGTAAAGTTGGGAAGG - Intergenic
1039033582 8:33334737-33334759 GCAGCGAAGTAAACAGAGGCTGG - Intergenic
1039306348 8:36267453-36267475 GCAGAGAAGGAGACAAGAGAAGG - Intergenic
1040502291 8:48015679-48015701 TCACAGAAGTAGACAGGAGATGG - Intronic
1041216651 8:55607726-55607748 GCAGAGAAGGAGAGAAGGGAAGG + Intergenic
1041748971 8:61238331-61238353 GGAGGGTAGTAAGCAGGGGAGGG - Intronic
1042338671 8:67656056-67656078 GCAGGGAAGCAAACAAGGGCAGG + Intronic
1044431483 8:92112728-92112750 GAAAAGAAGAAAAGAGGGGAGGG + Intergenic
1044478060 8:92651748-92651770 GCAGAAATGTCAAGAGGGGAAGG - Intergenic
1045391372 8:101718342-101718364 GGAGTGAAGTCAACAGGGGCTGG + Intronic
1046980051 8:120327442-120327464 GCAGTGAAGGAAGCAGGGTAGGG - Intronic
1047215895 8:122875864-122875886 TCAGGGAAGAAAACAAGGGAAGG - Intronic
1047914620 8:129568779-129568801 GGAAAGAAGTAAAGAAGGGAAGG + Intergenic
1048234944 8:132680739-132680761 GGAGAGAAGGAAAGAAGGGAGGG - Intergenic
1048511445 8:135066008-135066030 ACAGAAAAGTAACCAGAGGAAGG - Intergenic
1048864353 8:138748634-138748656 CCAGAGAAGCAAACAGGGTGAGG - Intronic
1049793397 8:144483892-144483914 GCAGAGAGATGAGCAGGGGAAGG - Intronic
1051042985 9:12837140-12837162 CCAGAGAAGTAAAAAGGAGCAGG - Intergenic
1051109583 9:13620664-13620686 GGAGAGAAGGAAAAAGGAGAGGG - Intergenic
1051287484 9:15511231-15511253 GCAGAGAAGCCAGCAGGGGCGGG - Intergenic
1051707208 9:19893152-19893174 GCAGAGAAGCAAGTAGGGCAGGG + Intergenic
1052118783 9:24682425-24682447 TCAGAGAAGTAATCAGAGAACGG - Intergenic
1052793637 9:32902170-32902192 GCAGAGAAGGAGAGAGGAGAAGG + Intergenic
1053804821 9:41790751-41790773 GAAGAAAAGAAAAAAGGGGAAGG - Intergenic
1054140465 9:61524714-61524736 GAAGAAAAGAAAAAAGGGGAGGG + Intergenic
1054418376 9:64901095-64901117 GGAGAGAAGTAAACAAAGCATGG - Intergenic
1054715399 9:68552537-68552559 GCAGAGACTTAGAGAGGGGATGG + Intergenic
1057142794 9:92737808-92737830 GCAGAGGAGGAAACAGTGGCAGG + Intronic
1058501344 9:105621257-105621279 GCAGAGAAAAGAACAGGAGATGG + Intronic
1059299539 9:113300951-113300973 GCAGAGGAGATAAAAGGGGATGG + Intronic
1059562861 9:115352021-115352043 GGAGAGAAGAAAAGAAGGGAGGG + Intronic
1059754684 9:117281715-117281737 GCAGGGAAGTAAAGTGGGGAGGG - Intronic
1060058574 9:120438224-120438246 ACTGAGAAGTAAACAGGTTAAGG + Intronic
1060247276 9:121957382-121957404 GCAGAGGAGGAAAGAGGGGGCGG - Intronic
1061213490 9:129206803-129206825 GCTGAGAAATTGACAGGGGATGG + Intergenic
1061292828 9:129661711-129661733 TCTGAGAAGTAGACAGGGCAAGG - Intergenic
1203520387 Un_GL000213v1:40398-40420 GCAGAGATGAGAACAGGGAAAGG + Intergenic
1203601961 Un_KI270748v1:19545-19567 GACGAAAAGTAAAAAGGGGATGG - Intergenic
1185485269 X:477224-477246 ACAGGGAAGTAAACAGGTGCAGG + Intergenic
1185591962 X:1283194-1283216 GAAGAGAAGGAAGCAAGGGAGGG - Intronic
1185603509 X:1354674-1354696 GAAGAGAAGAAAACAGGAGGGGG + Intronic
1185801471 X:3015148-3015170 GCAGAAAAGGAACCAGGGCAAGG - Exonic
1185918110 X:4058760-4058782 GCAGAGAGGAGAACAGGGGCAGG + Intergenic
1186348218 X:8716529-8716551 GCAGAGATGTAAGCATAGGAAGG + Intronic
1187169461 X:16836958-16836980 CCAGAGAAGTATACGGGGAAGGG - Intronic
1187216853 X:17285586-17285608 TCAGAGCAGGAAATAGGGGAGGG + Intergenic
1187587937 X:20684621-20684643 GCAAAGAAATAAAAAGGTGATGG + Intergenic
1188026553 X:25216290-25216312 GGAGGGAAGAAAACAGGAGAAGG - Intergenic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1190446565 X:50531396-50531418 GAAGAGAAGGAAAGAGGGAAGGG - Intergenic
1190915063 X:54805399-54805421 GCAGAGAGAAAAACAGGAGAGGG - Intergenic
1191129462 X:56992836-56992858 GCAGAAAAGTAAACAATGGAAGG - Intronic
1191963781 X:66733456-66733478 GTAGTGAAGTAAACAGGCAAAGG - Intergenic
1192637701 X:72835230-72835252 GCTGGGAAGTATAGAGGGGAGGG + Intronic
1192644013 X:72885585-72885607 GCTGGGAAGTATAGAGGGGAGGG - Intronic
1193106594 X:77682044-77682066 GCTGAGAAGTCAACAGGGAAAGG - Exonic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1193860900 X:86666199-86666221 GAAGAGGAGTAAACAGAGGTTGG - Intronic
1194632928 X:96308537-96308559 GCAGAGTAGTAAACAGAGTATGG + Intergenic
1194973548 X:100370478-100370500 GCAGAGAGGTTAGCAGGGGAGGG - Intronic
1195265146 X:103172674-103172696 GCAGAGAAGGAGACAAGAGAAGG - Intergenic
1195412063 X:104578208-104578230 GCAGAGAAGCAAAAAGATGAGGG + Intronic
1195605433 X:106801237-106801259 GGAAGGAAGTAAAAAGGGGAAGG + Intergenic
1195965705 X:110428317-110428339 GCAGATAAGTAAACAGACTATGG - Intronic
1198451634 X:136772257-136772279 GCTGAGAAGTATATTGGGGAAGG + Intronic
1198649017 X:138840482-138840504 GTAGAGAAGTATACAGTGGCAGG - Intronic
1198688252 X:139250815-139250837 GAGGAGAAGTAGACAGGGCATGG + Intergenic
1199140426 X:144305335-144305357 GCATAGAAGTGAACAGGTCAAGG - Intergenic
1199419426 X:147627018-147627040 GCTGAGAAGTAGACAGTGAATGG - Intergenic
1199650685 X:149944360-149944382 GGAGAGAAGAAAAGAGGAGAAGG + Intergenic
1200171181 X:154076322-154076344 TCAGAGAGGTCAACAGGGGCTGG - Intronic
1200786229 Y:7263264-7263286 ACAGGGAAGTAAACAGGTGCAGG - Intergenic
1201570192 Y:15405162-15405184 GCAGTGAAACAAGCAGGGGAAGG - Intergenic