ID: 1075852306

View in Genome Browser
Species Human (GRCh38)
Location 10:125599287-125599309
Sequence GCCCAGGACATGCGTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075852306_1075852309 -5 Left 1075852306 10:125599287-125599309 CCAGGGAGACGCATGTCCTGGGC 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1075852309 10:125599305-125599327 TGGGCTCTTGGAACCCGCTGAGG No data
1075852306_1075852312 17 Left 1075852306 10:125599287-125599309 CCAGGGAGACGCATGTCCTGGGC 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1075852312 10:125599327-125599349 GACCAGCTGACACCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075852306 Original CRISPR GCCCAGGACATGCGTCTCCC TGG (reversed) Intronic
901301013 1:8200255-8200277 GGCCGGGCCCTGCGTCTCCCCGG + Intergenic
901306980 1:8239844-8239866 CCCCAGGACAGGCTCCTCCCTGG - Intergenic
902377003 1:16034660-16034682 ACCCAGGACATCTGTCTCTCTGG - Intergenic
902382175 1:16057919-16057941 ACCCAGGACATCTGTCTCTCTGG - Exonic
902772856 1:18655843-18655865 GCCTAGGAGATGGGTCTCCCAGG - Intronic
905178868 1:36154952-36154974 TCCCAGGACAGGCTGCTCCCAGG + Intronic
905354539 1:37372246-37372268 GGCCAGGACATCTGTCTCCTGGG + Intergenic
906476906 1:46175530-46175552 GCCCTGGACCTGCATCTCCTAGG - Exonic
907331996 1:53677633-53677655 GCCCAGACCAGACGTCTCCCAGG + Intronic
911160256 1:94676828-94676850 GCCCATGACAGGTGTGTCCCAGG + Intergenic
916504633 1:165416988-165417010 GCCTAGGAAATGCCTCTCTCCGG + Intronic
920766657 1:208840123-208840145 GCCCAGGAAATGAGCCTCCCTGG + Intergenic
1063521206 10:6742948-6742970 GCCAAGGAGTTGCTTCTCCCTGG + Intergenic
1064093815 10:12407783-12407805 TCCCAGGATATGTGTTTCCCGGG - Intronic
1067048655 10:42999886-42999908 TCCCAGGCCCTGTGTCTCCCAGG - Intergenic
1067068719 10:43117655-43117677 GCCCAGCACATGCGTCCCGATGG - Intronic
1067879015 10:50027508-50027530 CCCCACAACATGCGTGTCCCAGG - Intergenic
1070917743 10:80165620-80165642 GCCCAGGCCAGACGTCTCTCTGG - Intronic
1072444910 10:95490701-95490723 GCCCAGGACTTTATTCTCCCTGG + Intronic
1073255808 10:102150399-102150421 TCCAGGGACATGCCTCTCCCTGG + Intergenic
1073469580 10:103714428-103714450 TCCCTGGACATGGGCCTCCCAGG + Intronic
1075008742 10:118850551-118850573 GCCCAGGCCCTGGGTCTTCCAGG - Intergenic
1075852306 10:125599287-125599309 GCCCAGGACATGCGTCTCCCTGG - Intronic
1076522736 10:131091047-131091069 GACCAGGAATTGAGTCTCCCTGG + Intergenic
1077296159 11:1827171-1827193 GTCCAGGACATGCCTCTGTCGGG + Intergenic
1078246167 11:9574367-9574389 GCCCAGGAGATGCGTCGCCGCGG + Exonic
1078620695 11:12904889-12904911 ACCCAGGAAAGGCGTCTCCTGGG + Intronic
1079218942 11:18541849-18541871 ACCCAGGTCTTGTGTCTCCCAGG - Intronic
1080109941 11:28555360-28555382 GGCCAGGAAATGCTTCTCTCAGG + Intergenic
1083263029 11:61533284-61533306 GCCCCGGGCATGGGTCTCCAGGG - Intronic
1083343137 11:61971894-61971916 TCCCAGGACAGCCGCCTCCCAGG + Intergenic
1083718130 11:64590861-64590883 GCCCAGCCCCTGCGCCTCCCAGG - Exonic
1083806830 11:65079411-65079433 GCCCCAGACATGACTCTCCCTGG - Exonic
1084089167 11:66869122-66869144 GCCCAGGTCATGCTCCTGCCTGG + Intronic
1091121749 11:133063395-133063417 GCCCACGAAATGTGGCTCCCTGG - Intronic
1091231207 11:133989033-133989055 GCCCAGGAGCAGCGTCCCCCCGG + Intergenic
1091659876 12:2375392-2375414 GCTCAGGAGATGCGTTTCCTGGG + Intronic
1092182820 12:6457749-6457771 GGCCAGGACATGGTTATCCCAGG + Intronic
1094006074 12:25752929-25752951 TCCCAGGACATTCCTATCCCTGG - Intergenic
1094473347 12:30823212-30823234 GCCCTGGACGCGCATCTCCCAGG + Intergenic
1100139899 12:91604705-91604727 TCCAAGGACTTGTGTCTCCCAGG + Intergenic
1102167663 12:110819635-110819657 GCCCAGGGCCTGCTTCACCCAGG + Intergenic
1102254995 12:111410084-111410106 GCCCAGGACATGTGTCCCCAGGG + Intronic
1102919274 12:116779663-116779685 CCCCGGGACCTGCTTCTCCCAGG + Intronic
1103942715 12:124509690-124509712 ACACAGGACAGGCCTCTCCCTGG - Intronic
1104108921 12:125688056-125688078 GCCAAGGACATGCTTTTCCTGGG - Intergenic
1104771288 12:131366376-131366398 TCCCAGGACCAGCCTCTCCCAGG + Intergenic
1106052343 13:26203550-26203572 GCCCAGGCCATGCTTCCCCCAGG + Intronic
1109531776 13:63659243-63659265 GCCCAGTACCTGCTTCTCCAAGG + Intergenic
1114673873 14:24428844-24428866 GCCCAGGGGGTGCCTCTCCCAGG + Exonic
1117363876 14:55005506-55005528 TCCCAGGAGAAGCTTCTCCCAGG + Intronic
1118765821 14:68908669-68908691 GTCCAGGACAGGCTTCTCCAAGG + Intronic
1119435376 14:74594860-74594882 GCCCAGGGGCTGTGTCTCCCAGG + Intronic
1119552360 14:75524200-75524222 GCACAGGACATGCCTCTCTCTGG + Intronic
1123124781 14:105938344-105938366 GGCCTGGGCATGTGTCTCCCAGG - Intergenic
1127588117 15:60397552-60397574 GCCGGGGACCTGCGGCTCCCTGG + Intronic
1129460678 15:75698678-75698700 CCCCAGCACATTGGTCTCCCTGG + Intronic
1129607459 15:77031790-77031812 GCCCAGCACACGGCTCTCCCGGG + Intronic
1129676484 15:77634694-77634716 GCCCAGCGCAGGCGACTCCCCGG + Intronic
1129724191 15:77893362-77893384 CCCCAGCACATTGGTCTCCCTGG - Intergenic
1129851580 15:78796828-78796850 GCCCAGGGCACACGTCTCCAGGG + Intronic
1130251410 15:82302268-82302290 GCCCAGGGCACACGTCTCCAGGG - Intergenic
1132195187 15:99909452-99909474 GCCCATGAAATGTGCCTCCCAGG + Intergenic
1132258619 15:100401356-100401378 GCCCAGGAGATGTGTCCCTCTGG + Exonic
1132665720 16:1080550-1080572 CCCCAGGACAGGCGTGACCCTGG - Intergenic
1134237017 16:12474459-12474481 GCCCACGCCCTGCCTCTCCCCGG - Intronic
1134626607 16:15726974-15726996 GCCCAGGACCCGCAGCTCCCCGG + Exonic
1135283057 16:21169874-21169896 TCCCAAGACATGAGTCACCCAGG - Intronic
1135327307 16:21534907-21534929 TTCCAGGACATGTGCCTCCCTGG + Intergenic
1136337656 16:29620930-29620952 TTCCAGGACATGTGCCTCCCTGG + Intergenic
1136609599 16:31358135-31358157 GCCCAGGACACCTGTCTCTCCGG + Intronic
1139583881 16:67888704-67888726 GCTCAGGACATCCATCCCCCAGG - Intronic
1141597859 16:85108180-85108202 GCTCTGGACACGCGGCTCCCGGG - Intronic
1142009205 16:87705196-87705218 GCCCAGGGCCTCTGTCTCCCGGG - Intronic
1142040414 16:87890078-87890100 TTCCAGGACATGTGCCTCCCTGG + Intronic
1142213431 16:88819321-88819343 GACCAGGACAGGCATCTCCGCGG - Intronic
1142247543 16:88976839-88976861 GCCCAGGACAGGCCTCTACCAGG + Exonic
1142355916 16:89601968-89601990 GCTCAGGAGATGTGGCTCCCGGG + Intergenic
1143378266 17:6479923-6479945 GGCCAGGCCATCCGTCTTCCTGG + Intronic
1143587338 17:7856809-7856831 GCCCAGCACACGGGGCTCCCCGG + Exonic
1145260850 17:21353660-21353682 TCCCAGAACATCCGTGTCCCAGG + Intergenic
1146044245 17:29489604-29489626 GCCCAGGACTTGAGTACCCCTGG + Intronic
1146724916 17:35148832-35148854 GCCCAGGGCATGCTCCTCACAGG - Intronic
1151187124 17:72372527-72372549 GCCCAGGCCAGACTTCTCCCAGG + Intergenic
1151651962 17:75475694-75475716 GCCCAGGCCCTGCATCCCCCAGG - Intronic
1152473064 17:80500879-80500901 CCCCAGAACATGCATCTCCTGGG - Intergenic
1152545155 17:80996755-80996777 GGCCAGGACATGTGTGTCCCAGG - Intronic
1160774808 19:850587-850609 GCCCAGGCTCTGCGTGTCCCCGG + Intergenic
1160896187 19:1402974-1402996 GACCAGGACATGCCTGTCCTGGG - Intergenic
1161705830 19:5820999-5821021 GCACAGGCCATGCCTCTGCCTGG + Intergenic
1162139223 19:8575885-8575907 TCCCAGGACCTGAGCCTCCCTGG + Intronic
1162184348 19:8892933-8892955 GAGGAGGACATGCGTCGCCCTGG - Exonic
1162185162 19:8898955-8898977 GGGGAGGACATGCGTCACCCTGG - Exonic
1163370719 19:16899798-16899820 GCCCAGGTCAGGCTTCTCCGTGG + Intronic
1164698137 19:30262272-30262294 GCCCAGGACATAGGTCCTCCAGG + Intronic
1164783575 19:30912382-30912404 GCCCAGGAAATGCCTTACCCAGG - Intergenic
1165952432 19:39481749-39481771 GCCCTGGACATCTGTGTCCCTGG - Intronic
1167097965 19:47385405-47385427 GCCCAGCTCCTCCGTCTCCCAGG + Intergenic
1167526033 19:49984384-49984406 GACCAGGTCAGGCATCTCCCAGG + Intronic
925101714 2:1252538-1252560 GCCCAGCACAGGCAGCTCCCAGG - Intronic
925266415 2:2569528-2569550 GGGCAGGACGTGCGTGTCCCAGG + Intergenic
929000800 2:37345126-37345148 GCACAGGAAATGTGTCTCGCCGG + Intronic
933886674 2:86724297-86724319 GGCCAAGACATTCCTCTCCCTGG + Intronic
933923506 2:87072410-87072432 GGCCAAGACATTCCTCTCCCTGG - Intergenic
934718053 2:96554577-96554599 GCCCAGGACAGACGTCCCACGGG - Intergenic
934783079 2:96985369-96985391 GCCCAGCACATCCCTCTGCCTGG + Intronic
934934055 2:98451874-98451896 GCCCAGTTCAAGCTTCTCCCTGG + Intronic
937681790 2:124652188-124652210 CACCAGGACATCCGTATCCCAGG + Intronic
946334018 2:219025675-219025697 GCCCAGGACTTGGGGCACCCAGG + Intronic
947344655 2:229178315-229178337 GCTCAGGACAGGCATCTCCTGGG + Intronic
948885269 2:240879063-240879085 CCCCAGGCCATGAGCCTCCCGGG + Exonic
948992755 2:241563125-241563147 GGCCAGGAGATGCCTCTCCAGGG - Intronic
1168993136 20:2111880-2111902 GCCCTGCAGCTGCGTCTCCCAGG - Intronic
1170506701 20:17033901-17033923 GCCCAGGACTTGAGGCTCACAGG - Intergenic
1173912553 20:46681088-46681110 GGCCAGGACAAGGGCCTCCCAGG + Intronic
1174182776 20:48685265-48685287 GCACAGGCCATGCTCCTCCCAGG + Intronic
1175262337 20:57682440-57682462 GCCCAGGTTCTGGGTCTCCCTGG + Intronic
1178918630 21:36723734-36723756 GCCCAGCCCATGCTCCTCCCTGG + Intronic
1181118953 22:20652678-20652700 CCCCACAACATGCGTGTCCCAGG + Intergenic
1181582569 22:23836394-23836416 GGCCAGGACAGGCGTCTCCTAGG - Intronic
1182520893 22:30884014-30884036 GGCCTGGAGCTGCGTCTCCCAGG + Intronic
1183676322 22:39300735-39300757 GCCCAGGACCCGCTCCTCCCAGG - Intergenic
1185028911 22:48431607-48431629 TCCCAGGACCTCTGTCTCCCAGG + Intergenic
1185108162 22:48885797-48885819 GCCCAGGACCTGCTGCTCCCTGG + Intergenic
950193433 3:10993122-10993144 GCCCAGGCCATCCGTCCCCTGGG + Intronic
954391098 3:50268281-50268303 GCCCAGGTCTTGGGTCTCCTGGG + Intronic
955137875 3:56238048-56238070 GCCCAGGACAAGAGTCCCTCTGG - Intronic
956229625 3:66998685-66998707 GCCCAGGAGAGGCGTCTGCGCGG - Intronic
960710009 3:120518666-120518688 GCCCAAGCCATGCTTTTCCCAGG - Intergenic
961346928 3:126269006-126269028 GCCCAGGACAGGCTCCTACCTGG - Intergenic
963268329 3:143260998-143261020 GCCCAGGAGTTGTTTCTCCCTGG - Intergenic
966927219 3:184652589-184652611 GCCCAGGACATACTTCCTCCAGG + Intronic
967876434 3:194271181-194271203 CCCCAGGACCTGGGGCTCCCTGG - Intergenic
968665489 4:1819568-1819590 GCCCAGGGCAAGAGTCTCACTGG + Intronic
968816286 4:2823490-2823512 GCCCAGGACATGCGTGAAGCTGG - Intronic
968926494 4:3551203-3551225 GGCCAGGGAATGCGTCTTCCTGG - Intergenic
975656019 4:76641894-76641916 CCCCAGCACCTGCCTCTCCCTGG - Intronic
981156458 4:141442218-141442240 GCTGAGGCCATGCCTCTCCCAGG - Intergenic
985995395 5:3594755-3594777 GCCCTGGCCGTGCGGCTCCCGGG - Intergenic
986013804 5:3740439-3740461 GCCCAGGCCTTGAGCCTCCCTGG - Intergenic
997195053 5:131973699-131973721 ACCCTGGACATGGGCCTCCCTGG + Intronic
998145453 5:139725185-139725207 GCCCCTGACAGGCGCCTCCCAGG - Intergenic
998469101 5:142369436-142369458 CACCAGAACCTGCGTCTCCCAGG - Intergenic
998546497 5:143032337-143032359 TCGCAGGACCTGTGTCTCCCAGG - Intronic
1001299780 5:170525146-170525168 GCCCAGGACAGCTGGCTCCCAGG - Intronic
1002192350 5:177484879-177484901 GCCCAGGACAGGAGTGTGCCTGG - Intronic
1002565787 5:180112534-180112556 GCCCAGGACTTACGGCTCCTTGG + Intronic
1002644768 5:180647763-180647785 GCCCAGGACACCCCTCTCCATGG + Intronic
1002779738 6:357150-357172 GCACATGACAGGCCTCTCCCAGG - Intergenic
1004198557 6:13527230-13527252 GCCCAGGAGATGCATCTCTAGGG - Intergenic
1005861855 6:29908097-29908119 GCCCAGGACAGGTTGCTCCCTGG - Intergenic
1005873516 6:29994754-29994776 GCCCAAGACAAGGGGCTCCCTGG - Intergenic
1007276539 6:40678425-40678447 GCTAAGGCCATGCTTCTCCCCGG - Intergenic
1010570083 6:77464597-77464619 GCTAAGGACATGGGTCTCACTGG - Intergenic
1011699466 6:89942305-89942327 GTGGAGGACATGCCTCTCCCAGG + Intronic
1016796368 6:148122160-148122182 GTCCAGGGCTTGCGTCTCCTTGG + Intergenic
1017745956 6:157447234-157447256 GCCCAGAACAGGGGCCTCCCTGG - Intronic
1018864665 6:167737290-167737312 GCCCAGGCCAGGCGGCGCCCTGG - Intergenic
1019168773 6:170117003-170117025 GCCCAGGACTGGCCTCTCCTGGG - Intergenic
1019515544 7:1438335-1438357 GCCGGGGACAAGGGTCTCCCTGG + Exonic
1020193995 7:6022966-6022988 ACCCAGGAGCTGCATCTCCCAGG - Exonic
1026321135 7:69268495-69268517 GCCCAGGCCGTGCCTCTGCCTGG + Intergenic
1027800472 7:82743941-82743963 ACCAAGGACATTCCTCTCCCTGG - Intergenic
1028774027 7:94658091-94658113 GCCCAGGCCCTGCCTCTCCCGGG + Intronic
1032089459 7:128904012-128904034 GCCCAGGCCCTGCACCTCCCTGG - Intronic
1034259867 7:149748285-149748307 GCCAAGGCCATGCTCCTCCCAGG - Intergenic
1034538905 7:151743757-151743779 GAACAGGACATGCTGCTCCCAGG - Intronic
1035064492 7:156095133-156095155 GCCCAGGAGATGGGGTTCCCAGG - Intergenic
1035399750 7:158557122-158557144 GCGCAGGGCAGGCGGCTCCCGGG + Intronic
1036689939 8:10939056-10939078 TCCCAGGACCTGCTTCTCCCAGG + Intronic
1037756824 8:21715612-21715634 GCCCAGGTCATGTTTCCCCCTGG - Intronic
1037928021 8:22859905-22859927 GCCCAGGAGATGTCTGTCCCTGG + Intronic
1038933467 8:32220833-32220855 TCCCAGGACCTGCGTCCCTCGGG + Intronic
1049606736 8:143533073-143533095 GCCCTGGACACGCCCCTCCCAGG + Intronic
1060420647 9:123467295-123467317 GCACAGAACATGTGTCTCCATGG - Intronic
1061453699 9:130682256-130682278 GCCCAGAAGATGCATCTCTCCGG - Exonic
1062095585 9:134701582-134701604 GCCCAGTACGTGAGTCTCCTGGG + Intronic
1062554189 9:137106607-137106629 GCCCAGGATGTGCCTGTCCCTGG + Intronic
1188957717 X:36453675-36453697 GCCCAGGACATGTTTTTCCACGG + Intergenic
1190690234 X:52907683-52907705 GCCCTGCACCAGCGTCTCCCAGG - Exonic
1190695749 X:52948109-52948131 GCCCTGCACCAGCGTCTCCCAGG + Exonic
1192632877 X:72790681-72790703 GCCCAGGACTCGAGTCTGCCTGG + Intronic
1192648832 X:72930120-72930142 GCCCAGGACTCGAGTCTGCCTGG - Intronic
1195940344 X:110162438-110162460 ACCCAGGCCATGCTTCACCCTGG - Intronic
1200064197 X:153496988-153497010 GCCGAGGACATGTGACTCCCGGG - Intronic
1200126296 X:153816433-153816455 GCCGAGGACATGTGACTCCCGGG + Intronic
1200222428 X:154397737-154397759 TCCCAGGCCATGAGTCTCCGTGG + Intronic
1200771322 Y:7128067-7128089 GCCCATGGCATGCCTCTCCTTGG + Intergenic
1200985380 Y:9297601-9297623 GCCTAGGAAATGTGCCTCCCAGG + Intergenic