ID: 1075852308

View in Genome Browser
Species Human (GRCh38)
Location 10:125599303-125599325
Sequence TCAGCGGGTTCCAAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075852308_1075852312 1 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852312 10:125599327-125599349 GACCAGCTGACACCAGTGCCAGG No data
1075852308_1075852318 21 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852318 10:125599347-125599369 AGGCCACCACACCTGCCCTGGGG No data
1075852308_1075852319 22 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852319 10:125599348-125599370 GGCCACCACACCTGCCCTGGGGG No data
1075852308_1075852316 19 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852316 10:125599345-125599367 CCAGGCCACCACACCTGCCCTGG No data
1075852308_1075852317 20 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852317 10:125599346-125599368 CAGGCCACCACACCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075852308 Original CRISPR TCAGCGGGTTCCAAGAGCCC AGG (reversed) Intronic
900584604 1:3426375-3426397 TCCCCAGGTTCCCAGAGCCCAGG - Intronic
904854500 1:33487376-33487398 TCAGCTGGTTCCAAGTTCACAGG - Intronic
905854044 1:41295574-41295596 TCAGGGGCTTCCAACAGACCAGG - Intergenic
906359676 1:45142941-45142963 TGAGCGGGTCACACGAGCCCAGG + Intronic
909023477 1:70458034-70458056 TCACCGTGATCCAAGAGCCCAGG - Intergenic
910574391 1:88743377-88743399 TCAGCGGGTTCCTATGGCCAGGG - Intronic
917931630 1:179826478-179826500 CCAGCGGGTTCCTAGACCTCAGG - Intergenic
918447914 1:184633130-184633152 CCAACGGGCTGCAAGAGCCCGGG + Intergenic
920814183 1:209315431-209315453 TGAGAGGGTTCCATTAGCCCCGG - Intergenic
923206812 1:231767180-231767202 GCAGTGGGTTCCAACAGCCTCGG - Exonic
1064354630 10:14605625-14605647 TCAGTGGGTTCCAGGGACCCAGG - Intronic
1067015488 10:42754383-42754405 TCCGAGGCTTCCAGGAGCCCCGG - Intergenic
1071988108 10:91073041-91073063 TCAGAGGGTTTCAGGAGTCCTGG + Intergenic
1075150216 10:119922319-119922341 GCAGAGGGTTCCAAAGGCCCAGG + Intronic
1075420783 10:122298947-122298969 GCAGAGGGTGCCAAGAGCTCAGG + Intronic
1075852308 10:125599303-125599325 TCAGCGGGTTCCAAGAGCCCAGG - Intronic
1077007524 11:365291-365313 TCTGTGGGTTCCAGGAGCACCGG - Intergenic
1077160902 11:1112520-1112542 TGAGCGGGTTCCAGGACCCAGGG - Intergenic
1082810124 11:57474552-57474574 TCAGCAGGTTCCAGGAGGTCTGG - Intronic
1083333946 11:61912190-61912212 TCAGCGGGCTGCCAGGGCCCAGG + Intronic
1084890714 11:72235620-72235642 TCTGTGGGATCCAGGAGCCCAGG + Intronic
1086686195 11:89735669-89735691 TCAGTCTGTTCCATGAGCCCAGG + Intergenic
1087796351 11:102458478-102458500 TGAGAGGATTACAAGAGCCCAGG + Intronic
1088412618 11:109551916-109551938 TGGGAGGGTTCCTAGAGCCCAGG + Intergenic
1092968429 12:13668542-13668564 TCACTGAGCTCCAAGAGCCCTGG - Intronic
1095957322 12:47814135-47814157 GCAGCAGATTCCAAGGGCCCAGG + Intronic
1098175201 12:67783051-67783073 GCAGCTGGATCCAAGATCCCAGG + Intergenic
1101418134 12:104526728-104526750 TCTGGGGGTTCCGAGAACCCTGG + Intronic
1101901902 12:108797217-108797239 TCAGAGGGTTGCTTGAGCCCAGG - Intronic
1104952815 12:132450050-132450072 TCAGCAGGTTCCCAAGGCCCTGG + Intergenic
1114455272 14:22849732-22849754 CCAGCTGGTGCCAGGAGCCCTGG - Intergenic
1117458463 14:55921111-55921133 TCAGAGGGTTCACAGATCCCTGG - Intergenic
1120903459 14:89596532-89596554 CCAGCTGGTTTCAAGAGGCCAGG - Intronic
1122132858 14:99615449-99615471 TGAGAGGGTTACTAGAGCCCGGG + Intergenic
1123030674 14:105449700-105449722 TCGGCGGCTGCCAAGAGCCCAGG - Intronic
1124713646 15:32036100-32036122 TCAGCGGCTGCCAAGAGCTGTGG - Intronic
1125827551 15:42689184-42689206 TCAGAGGGCTCCAACAGCCTAGG - Exonic
1128513385 15:68327159-68327181 TGAGGGGGATCCCAGAGCCCAGG - Intronic
1132537636 16:490932-490954 TCAGCTGCCTCCAGGAGCCCAGG - Intronic
1136704212 16:32172745-32172767 GCAGAGGGTGCCATGAGCCCTGG - Intergenic
1136763697 16:32756661-32756683 GCAGAGGGTGCCATGAGCCCTGG + Intergenic
1136804402 16:33113725-33113747 GCAGAGGGTGCCATGAGCCCTGG - Intergenic
1136935820 16:34463447-34463469 TGAGAGGGTTCCTTGAGCCCAGG + Intergenic
1136963998 16:34885123-34885145 TGAGAGGGTTCCTTGAGCCCAGG - Intergenic
1138072918 16:54010814-54010836 TCAGCTGGTTTCCAGAGGCCAGG - Intronic
1138185007 16:54970142-54970164 TCAGAGGCTTCCAAAAGCACAGG - Intergenic
1140247617 16:73265510-73265532 TCAGCTTATTCCAAGAGTCCTGG - Intergenic
1140926657 16:79590131-79590153 TCTGCGGGGCCCAATAGCCCTGG - Intronic
1141333091 16:83129934-83129956 ACAGGGGGTTTCAAAAGCCCAGG - Intronic
1142227217 16:88883405-88883427 CCAGCGTGTTCCGAGAGCCCTGG - Intronic
1203065847 16_KI270728v1_random:1016982-1017004 GCAGAGGGTGCCATGAGCCCTGG + Intergenic
1142923812 17:3215023-3215045 TCAGAGGGATCCCAGAGCCCAGG - Intergenic
1144562384 17:16331686-16331708 GCAGAGGGTTCCTTGAGCCCAGG - Intronic
1144712433 17:17410724-17410746 CCAGGGGGTTCCTAGGGCCCTGG - Intergenic
1146705700 17:34999241-34999263 TCTGCCAGTCCCAAGAGCCCAGG - Intronic
1147549372 17:41428627-41428649 TGAGAGAATTCCAAGAGCCCAGG - Intergenic
1151340746 17:73469327-73469349 ACTGCGGGTTCCAAGGGCCCTGG - Intronic
1151387889 17:73766451-73766473 TCAACTGGTCCCAAGAGCCACGG + Intergenic
1152282300 17:79392068-79392090 GCAGCGGGTCCGAAGTGCCCGGG - Intronic
1203183696 17_KI270729v1_random:91138-91160 TGAGAGGGTTCCTTGAGCCCAGG - Intergenic
1155351498 18:24911779-24911801 CCAGGGTGCTCCAAGAGCCCAGG - Intergenic
1160427463 18:78788027-78788049 GCAGTGGCTTCCCAGAGCCCCGG + Intergenic
1160735449 19:660314-660336 TCAGCCTGATCCCAGAGCCCAGG + Intronic
1160938441 19:1608937-1608959 GAAGTGGGTTCCAACAGCCCGGG + Intergenic
1161993273 19:7697382-7697404 GCAGGTGGTTCCAAGAACCCAGG - Intronic
1162524811 19:11201143-11201165 TGAGAGGGGTCCAAGAACCCAGG + Intronic
1163674194 19:18647131-18647153 TCGGCAGGTCCCAAGAGCTCTGG + Intronic
1164323458 19:24171228-24171250 TCGGTGGGTTCCCAGAGCTCAGG - Intergenic
1165311570 19:35031813-35031835 TCAGTGGGCTGCAAAAGCCCTGG + Intronic
1165427359 19:35753512-35753534 TCAGGGGTTCCCAAGAGCCGAGG + Intronic
1165708708 19:37994500-37994522 TCAGTGGTTTTCAAGAGCCAAGG - Intronic
1166121085 19:40687150-40687172 CCACCTGGTTCCAAGGGCCCAGG + Intronic
1167147544 19:47692084-47692106 TCAGTAGGTTCCAAGGGCTCAGG - Intronic
1168146250 19:54421227-54421249 TCAGCGGGTCCCAGGACCCCGGG - Intronic
925928375 2:8685987-8686009 TCCTCGGGTTCCCAGTGCCCGGG - Intergenic
926057224 2:9781068-9781090 TCAGGGGGTTCCTATAGCACTGG + Intergenic
926093672 2:10066359-10066381 GCAGTGGGTCCCAAGATCCCTGG - Intronic
926715083 2:15918017-15918039 TCAGCGGCTTCCCAGGGACCTGG + Intergenic
930209143 2:48616773-48616795 TCAGTGGGTTGCTTGAGCCCAGG + Intronic
930651723 2:53970771-53970793 TCGGCCGGCTCCATGAGCCCAGG + Exonic
932456167 2:71851390-71851412 TCAGCAGGGGCCCAGAGCCCAGG - Intergenic
932667243 2:73707891-73707913 TCAGGGGGCCCCAAGAGCCCTGG + Intergenic
932823380 2:74920113-74920135 ACTGCGGGGTCCAAGAGCACAGG - Intergenic
933368934 2:81390794-81390816 TTAGCTGGGTCCAATAGCCCAGG - Intergenic
939148992 2:138450473-138450495 CCAGAGGGTTCCTTGAGCCCAGG + Intergenic
940800423 2:158126800-158126822 TCACCTGGCACCAAGAGCCCAGG + Intronic
946011839 2:216571547-216571569 TCAGTGGTTTCCAGGAGCCTGGG + Intronic
1172971350 20:38875234-38875256 ACAGAGGGTTCCAGAAGCCCTGG + Intronic
1175636196 20:60586465-60586487 ACAGCAGGGTCCAACAGCCCAGG - Intergenic
1175696732 20:61108367-61108389 TCAGGGGGTTCCAAGAGGATGGG - Intergenic
1178684721 21:34702138-34702160 TCAGGGTGTTCCTAGAGCACAGG - Intronic
1179457223 21:41508004-41508026 TCGGCGGGTCCCAGGCGCCCAGG + Exonic
1180839408 22:18952160-18952182 TCAGCGGGTACAGAGATCCCAGG + Intergenic
1181062492 22:20288324-20288346 TCAGCGGGTACAGAGATCCCAGG - Intergenic
1181082827 22:20425712-20425734 TCCGTGGGCTCCAAGAGGCCGGG + Exonic
1184699895 22:46163720-46163742 GCAGCGGGGCCCAGGAGCCCCGG - Intronic
1184749681 22:46478114-46478136 TCAGCAGGTACCAGGAGCCCGGG + Intronic
949304026 3:2619285-2619307 CCAGCTGGTAGCAAGAGCCCAGG - Intronic
954021135 3:47742808-47742830 TCAGCGGATTGCTTGAGCCCAGG - Intronic
954352884 3:50060055-50060077 GGAGCGGGTTACATGAGCCCAGG + Intronic
954721984 3:52572275-52572297 TCGGCATGTTTCAAGAGCCCAGG + Intronic
961456185 3:127025238-127025260 TCAACGGGTGCCAAGGGCTCAGG - Intronic
967477659 3:189940109-189940131 TCTGTGGGTTCAAAGAGACCAGG + Intergenic
979941285 4:126766422-126766444 TCAGCTAGTTCCAAGAGGTCAGG - Intergenic
986858574 5:11902170-11902192 TCTGTGGGTTCCAAGGGCTCAGG - Intronic
991403379 5:66277494-66277516 TGAGAGGGTTCCAGGAGCCAAGG + Intergenic
998327049 5:141290067-141290089 TCAGAGGGTCCCAAGACCCCAGG - Intergenic
1000039004 5:157471203-157471225 TCACCAGGTTCTAAGAGGCCAGG - Intronic
1001004701 5:168039877-168039899 GCAGCGGGTTCCAGGAGACAAGG + Intronic
1004343621 6:14828751-14828773 TCTGTGGATTCCAAGAGCCAAGG + Intergenic
1005863829 6:29923379-29923401 TCAGAGGGTCCCTTGAGCCCAGG - Intergenic
1005959789 6:30686793-30686815 CCAGCGCGTTCCCAGAACCCTGG + Exonic
1006047318 6:31308602-31308624 TGTGCGGGTTCCCGGAGCCCAGG - Intronic
1006511531 6:34524138-34524160 CCAGCAAGTTCCAAGAACCCTGG + Intronic
1007638710 6:43318414-43318436 TCTGCCTGTTCCAAAAGCCCAGG - Intronic
1007917226 6:45572877-45572899 TCAGTGGCTTCCTAGGGCCCCGG - Intronic
1009456084 6:63858077-63858099 TCAGCCTGTTCAAAGAGCTCAGG + Intronic
1011272596 6:85594190-85594212 CCAGCGGGCTCCACGAGCTCCGG - Intronic
1022527557 7:31048401-31048423 TCAGAGGATTCCAAGCGTCCTGG + Intergenic
1022703672 7:32784003-32784025 TCCTCTGGTTCCAAGAGCACTGG - Intergenic
1022973570 7:35537674-35537696 TCTGCGGAGTCCATGAGCCCTGG + Intergenic
1024244071 7:47456229-47456251 CCAGCAGGCTCCAGGAGCCCAGG + Intronic
1026899458 7:74028724-74028746 TCAGCAGGTTCCTTGACCCCTGG + Intronic
1030251044 7:107445090-107445112 TCAGGAGCTTCCAGGAGCCCAGG + Intronic
1031347556 7:120687586-120687608 TGAGTGGGTTGCATGAGCCCAGG + Intronic
1035734784 8:1880274-1880296 TCGGGGGATTCCAGGAGCCCCGG - Intronic
1037168085 8:15855512-15855534 TCAGTGGGATCCAAGAACCAAGG - Intergenic
1037220637 8:16515892-16515914 GCAGCGGGTTCAAAGAATCCAGG + Intronic
1042654176 8:71077501-71077523 TGAGGGGGCTCCAAGAGCACTGG - Intergenic
1048283529 8:133123271-133123293 TGAGGGGGTTCCAAGGGGCCAGG - Intronic
1049351233 8:142165884-142165906 TCAGAGGGCTCCAAGCGCTCAGG - Intergenic
1052805552 9:33010184-33010206 TCTGACGGTGCCAAGAGCCCAGG - Intronic
1052832838 9:33229755-33229777 TCAGTCGGTTCCAGGAGCCCTGG - Intronic
1056280944 9:85040775-85040797 GCAGCGGGCTCCAAAAGCCAAGG - Intergenic
1056956276 9:91084172-91084194 TAAGGGGGTTTCAAGAGCCAAGG + Intergenic
1059143266 9:111874436-111874458 CCAGAGTGTTCCAAGAGGCCTGG + Intergenic
1060347045 9:122826581-122826603 TAAGCCTGTTCCCAGAGCCCAGG + Intronic
1062192376 9:135254630-135254652 TCAGCTGGTGCCCAGGGCCCAGG + Intergenic
1189438524 X:41013758-41013780 TGAGAGGATTCCATGAGCCCAGG + Intergenic
1190901943 X:54683948-54683970 TCAGTGGTTGCCAAGAGTCCAGG - Intergenic
1192753325 X:74018388-74018410 TCAGAGAGCTCCAACAGCCCAGG + Intergenic
1195802762 X:108732666-108732688 TCGCCGGGTGCCAAGACCCCCGG - Exonic
1198115585 X:133541990-133542012 TCAGTGGGCTGCAAGAGCCTTGG - Intronic
1198957398 X:142147968-142147990 TCTGTGTGGTCCAAGAGCCCAGG - Intergenic