ID: 1075852312

View in Genome Browser
Species Human (GRCh38)
Location 10:125599327-125599349
Sequence GACCAGCTGACACCAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075852308_1075852312 1 Left 1075852308 10:125599303-125599325 CCTGGGCTCTTGGAACCCGCTGA 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1075852312 10:125599327-125599349 GACCAGCTGACACCAGTGCCAGG No data
1075852306_1075852312 17 Left 1075852306 10:125599287-125599309 CCAGGGAGACGCATGTCCTGGGC 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1075852312 10:125599327-125599349 GACCAGCTGACACCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075852312 Original CRISPR GACCAGCTGACACCAGTGCC AGG Intronic
No off target data available for this crispr