ID: 1075855215

View in Genome Browser
Species Human (GRCh38)
Location 10:125624228-125624250
Sequence GTTCTTAGGGGGATAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075855215_1075855223 26 Left 1075855215 10:125624228-125624250 CCATTCACTATCCCCCTAAGAAC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1075855223 10:125624277-125624299 ATGCTCATGTGAATTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075855215 Original CRISPR GTTCTTAGGGGGATAGTGAA TGG (reversed) Intronic
901330717 1:8406002-8406024 GTTGTTAGGGGGAAAGGGAAGGG - Intronic
903261584 1:22134362-22134384 GTTCTTAGGGGGATGGTACCTGG + Intronic
904200960 1:28818773-28818795 GTTCTCATGGGGATGGTGAGAGG + Intronic
907725077 1:57012567-57012589 ATTCTTAAGGGGATACTGATGGG + Intronic
908491851 1:64652499-64652521 GTTCTTTGAGGGGTAGGGAACGG + Intronic
908912602 1:69089475-69089497 TTTTTTAGGGGGATGGGGAAGGG + Intergenic
911293095 1:96081450-96081472 TTTCTTTGGGGGATGGAGAAGGG - Intergenic
911740233 1:101378982-101379004 ATTCTAAGTGGGATAGAGAATGG - Intergenic
913411134 1:118553034-118553056 CTTCTTATGGCGATTGTGAATGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914734255 1:150400714-150400736 GTTCTTAGGGGGATAGCTTTTGG + Intronic
915530356 1:156499533-156499555 GGTCTTAGGGGGATGGGGAAAGG - Intronic
917487462 1:175467958-175467980 GTCCTTAGGGAGAGAGGGAATGG + Intronic
921362370 1:214341752-214341774 GTTCTTTGTTGGTTAGTGAAAGG + Intergenic
922914296 1:229243157-229243179 GTTCTGAGGAGGAAAGGGAAGGG + Intergenic
1068950539 10:62772533-62772555 GTGCTTCGGGGGAAAGTGGAGGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1070734987 10:78857072-78857094 GTTCTTAGGAGGAAAGAAAATGG + Intergenic
1075855215 10:125624228-125624250 GTTCTTAGGGGGATAGTGAATGG - Intronic
1080896631 11:36453720-36453742 GTTCTGAGGGGGAAAGTACAGGG + Intronic
1081179472 11:39968479-39968501 ATTCTTAGTGGGATGGGGAAAGG - Intergenic
1084295217 11:68208973-68208995 TTTCCAAGGGGGAAAGTGAAGGG + Intronic
1086864661 11:91965623-91965645 GACCTGAGGGGAATAGTGAAAGG + Intergenic
1087063825 11:94009391-94009413 GGTATGAGGGGGATTGTGAAGGG + Intergenic
1097081590 12:56435325-56435347 ATTCTTTGGGAGATAGTGATAGG - Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099889973 12:88579352-88579374 TTTCTAAGGGGGAAAGTGAGAGG + Intronic
1106266211 13:28112598-28112620 TTTCTAAGGGCCATAGTGAAGGG - Intergenic
1112395608 13:99028062-99028084 GTTATTAGGGTAATAGTGAGAGG - Intronic
1112543965 13:100346253-100346275 GTTCTTAAGGGGATCTAGAATGG - Intronic
1112912392 13:104503564-104503586 GTTCTTTGGGGGATGGTGAGGGG + Intergenic
1115278354 14:31633175-31633197 GTTTTTAGGTGCATAGTGCATGG + Intronic
1130178790 15:81604753-81604775 GTTTTTTGAAGGATAGTGAATGG - Intergenic
1130445993 15:84002545-84002567 GTTGTTTGGAGGATAGGGAATGG - Intronic
1135985822 16:27183361-27183383 GTTCTTAGGGTGCTATTTAAAGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138550869 16:57747754-57747776 GTTCTTCGGTGAATACTGAATGG - Intronic
1141029567 16:80575654-80575676 GTCCCTAGTGGGATAGAGAAAGG - Intergenic
1143988675 17:10938002-10938024 GTTCTTAAGTGTATAGAGAAAGG - Intergenic
1144297984 17:13897395-13897417 GTTCTTAAGAAGATAATGAAGGG - Intergenic
1145122355 17:20271790-20271812 ATTCTCAGGGAGATACTGAAGGG - Intronic
1146491188 17:33283555-33283577 GTTCTTAGGGAAAAAGTGATGGG - Intronic
1148504797 17:48118898-48118920 GTTCTTAAGAGGATGGGGAATGG + Intronic
1153068983 18:1082998-1083020 GTTCTTAGTGGCAAAGTGACTGG - Intergenic
1158260116 18:55597388-55597410 TTTCTTTGGGGGAGAGGGAAGGG - Intronic
1158436644 18:57438996-57439018 GGTCTTAGGGGTACAGTTAAAGG + Intronic
1158872727 18:61704039-61704061 GATTTTAGGGGGATAGTTAAGGG + Intergenic
926354941 2:12033217-12033239 TTTTTTAGGGGGAAAGGGAATGG + Intergenic
926354954 2:12033301-12033323 TTTTTTAGGGGGAAAGGGAATGG + Intergenic
927639084 2:24835403-24835425 GATCTGAGGGGGAAAGTGATGGG + Intronic
928064741 2:28152129-28152151 GCTCTTTGGGGGATAGAAAAGGG - Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
934033838 2:88071844-88071866 GTTCTCAGGGGGAAAGTGAGTGG + Intronic
934855816 2:97729113-97729135 ATGCTTTGGGGGATTGTGAAAGG - Intronic
936961998 2:118085812-118085834 GTTCTTAGAGGCTTACTGAATGG + Intergenic
943328579 2:186531549-186531571 GTTCTGAGGTGGATTGTGCAGGG + Intergenic
944197729 2:197073131-197073153 GTTCTAAAGGGGATAGGCAAAGG + Intronic
944423335 2:199554523-199554545 ATTCTTAGTGGGACAGTGACTGG + Intergenic
946504749 2:220286900-220286922 GTTATCAAAGGGATAGTGAAAGG + Intergenic
947174276 2:227347091-227347113 TTTCTTGTGGGGAGAGTGAAGGG + Intronic
1170480098 20:16756791-16756813 GTACTCAGGTGGAAAGTGAAAGG + Intronic
1172653948 20:36525638-36525660 GATCTTTGGGGGATAGTCTAAGG - Intronic
1173002577 20:39115191-39115213 GTGCTTAGGGGGCAAGTGAGAGG - Intergenic
1173428811 20:42967671-42967693 GGTATTAGGGGGCTGGTGAATGG - Intronic
1174029085 20:47606569-47606591 GTACTTAAGGGTACAGTGAAAGG - Intronic
1174999235 20:55608387-55608409 GTTCTTAGAAGGAAAGGGAATGG + Intergenic
1175071235 20:56335625-56335647 GTGCTCAGGGGGCTAGAGAATGG + Intergenic
1175558672 20:59897372-59897394 GTTTTTAGTGGCATAGTGAATGG + Intronic
1177368303 21:20167947-20167969 GTTCTCAGGGGGACTGTGAGAGG + Intergenic
1179947957 21:44691406-44691428 GTTCTTAGGGTCTTAGTGTACGG - Intronic
950294325 3:11815264-11815286 ATTCTCAGGGTGATAATGAAGGG + Intronic
953544420 3:43853879-43853901 GTCCTTGGGGGGAGAATGAAAGG - Intergenic
955192056 3:56770678-56770700 GTCCTTGGGGGGACAGTGAATGG - Intronic
962647492 3:137454896-137454918 GTTGTTTGGGGGAGAGGGAAGGG - Intergenic
965387800 3:168065644-168065666 GTTATTATGGGAAAAGTGAATGG - Intronic
969207070 4:5655163-5655185 GTTCTTATGGGGTTTGTAAAGGG - Intronic
972489273 4:39571646-39571668 GATGTTAGGGAGAGAGTGAATGG + Intronic
973572017 4:52250395-52250417 GTTCTTAAGGTGCTAGAGAATGG + Intergenic
973713319 4:53650702-53650724 GTTCTTGGGGGGACACGGAAGGG - Intronic
974236060 4:59182779-59182801 GTTTTTTGGGGGATAGGGTATGG + Intergenic
976024195 4:80667130-80667152 TTTCTTATGGGGATAAAGAATGG - Intronic
976562855 4:86521816-86521838 GGTGGTAGGGGGATGGTGAATGG - Intronic
976931882 4:90576530-90576552 GTTGTTAGGGGGTGAGTGGAGGG - Intronic
982305337 4:153924529-153924551 GGTCTTAGGGGGATGGGAAATGG - Intergenic
983795714 4:171860073-171860095 GTTCTTATGTGGACAGTAAAAGG - Intronic
983802467 4:171950289-171950311 GTACTTAGGGTAATAGGGAAGGG + Intronic
984139824 4:175990559-175990581 TTTCTTAGGGGTCTACTGAAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990073810 5:51817652-51817674 GTGCTGAGGGGGAAAGAGAAGGG + Intergenic
990222570 5:53609130-53609152 GTTCTTAGTGGCATCTTGAATGG + Intronic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
992663389 5:78983630-78983652 GTACTAAGGTGGATGGTGAAGGG + Intronic
993870819 5:93252298-93252320 GTTCTCATGGTGATGGTGAAAGG + Intergenic
994940714 5:106320393-106320415 GTTCTCAGATGGAGAGTGAATGG - Intergenic
995443961 5:112222438-112222460 TTTCTCATGGGGATACTGAAAGG + Intronic
996249153 5:121305813-121305835 TTTTTTAGGGGTATAGAGAAAGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
997550579 5:134748722-134748744 GTTCTTTGGGGTATAGGGACTGG - Intronic
998950392 5:147388134-147388156 GGACTTAGGGACATAGTGAAAGG - Intergenic
998953263 5:147413203-147413225 TTTCTTAGGGGGAGAGTCAGAGG + Intronic
1005128377 6:22474297-22474319 GTTCTTTGGGGGAGACTGAAAGG + Intergenic
1007311418 6:40949187-40949209 TCTCTTAGGAGGATTGTGAATGG - Intergenic
1007697068 6:43740664-43740686 GGTCTTAAGGGGTTAGAGAAGGG - Intergenic
1009427697 6:63532585-63532607 TTTAATAAGGGGATAGTGAATGG - Intronic
1009703358 6:67212535-67212557 GATCTCAGAGAGATAGTGAATGG - Intergenic
1015010190 6:128336699-128336721 GTTCTTAGGGAGATACTTGATGG - Intronic
1015053518 6:128871515-128871537 GTACTTAGGGAGACAGTGATGGG - Intergenic
1018422548 6:163652082-163652104 GATCCGAGGGGCATAGTGAATGG + Intergenic
1022548184 7:31208706-31208728 CTTCTTAGGGGAATAGTTAGGGG + Intergenic
1026521535 7:71122339-71122361 GTTTCTAGGGGGACAGTGCAGGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027895161 7:84032195-84032217 GTCCCTAGGGGTCTAGTGAAAGG + Intronic
1028314372 7:89382604-89382626 GTTGTTCTGGTGATAGTGAATGG + Intergenic
1032336611 7:131030599-131030621 GTTCTTAGAGGGATAGAGGAGGG + Intergenic
1033593897 7:142840507-142840529 GATCTTAGTGAGAAAGTGAATGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034278659 7:149836588-149836610 ATTCAAAGGGGGATAGTGCAAGG - Intergenic
1038178539 8:25204290-25204312 GGTTTTTGGGGGATAGTGCATGG + Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1049009556 8:139878355-139878377 GTTGTTTTGGGGATAGGGAAAGG + Intronic
1050024359 9:1318970-1318992 GATCTTAGGAGGAGAGGGAAAGG - Intergenic
1050770791 9:9197204-9197226 GTGCTTTGGGGGAAAGTGTAAGG - Intronic
1051822463 9:21183487-21183509 GCTCTTAAGGGGAAAGTGATGGG + Intergenic
1051823706 9:21195548-21195570 GCTCTTAAGGGGAAAGTGATGGG + Intergenic
1051825522 9:21214076-21214098 GCTCTTAAGGGGAAAGTGATGGG + Intronic
1056104350 9:83332398-83332420 GTTCTTTGGGGGATGGTGGGGGG - Intronic
1057095509 9:92304520-92304542 CTTCTTAGGGGTATAGGGAGGGG + Intronic
1057309870 9:93935349-93935371 GCACTTAGGTGGAGAGTGAATGG + Intergenic
1058145509 9:101406587-101406609 TTTCTTAGGGGAATAGGAAAAGG + Intronic
1059257727 9:112945988-112946010 GTTCTGAGGGGGAAAGGAAAGGG + Intergenic
1060534382 9:124372413-124372435 GTTCTTAGAGGAGTAATGAAAGG - Intronic
1192669501 X:73125095-73125117 GTCCTCTAGGGGATAGTGAAAGG - Intergenic
1194036265 X:88876098-88876120 GCTCTTCTGGTGATAGTGAATGG + Intergenic
1194861887 X:99009623-99009645 ATTATTAGGAGGACAGTGAAGGG + Intergenic
1196999617 X:121424375-121424397 TTTCTGAGGGGAATAATGAAAGG - Intergenic