ID: 1075856222

View in Genome Browser
Species Human (GRCh38)
Location 10:125632288-125632310
Sequence GAACCAGGGTTGGTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075856222_1075856230 12 Left 1075856222 10:125632288-125632310 CCAGCAGAAACCAACCCTGGTTC 0: 1
1: 0
2: 2
3: 21
4: 173
Right 1075856230 10:125632323-125632345 TTTATCTGGTGAAATCCTCTTGG No data
1075856222_1075856228 -2 Left 1075856222 10:125632288-125632310 CCAGCAGAAACCAACCCTGGTTC 0: 1
1: 0
2: 2
3: 21
4: 173
Right 1075856228 10:125632309-125632331 TCTGCCTTGGGATATTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075856222 Original CRISPR GAACCAGGGTTGGTTTCTGC TGG (reversed) Intronic
900396072 1:2453769-2453791 GACCCAGGGCTGGCATCTGCTGG - Intronic
900818781 1:4870471-4870493 GATCAAGGGTTGCTTTCTTCTGG - Intergenic
908651340 1:66336581-66336603 GAACAAAGGTTGGGTGCTGCTGG + Intronic
910172555 1:84393197-84393219 GAAAAAGGGATGGTTTGTGCAGG - Intergenic
910961659 1:92770121-92770143 GTAGCAGGGCTGGTTTCTTCTGG - Intronic
911018100 1:93356906-93356928 GAAACAGGGTTGCATCCTGCTGG + Intronic
911479433 1:98419504-98419526 AAACCTGGGGTGGTTTCTGGAGG - Intergenic
917780712 1:178393164-178393186 GGACCAGGGTTGGGTTGTGGGGG + Intronic
918242823 1:182635197-182635219 GAAGGAGAGTTGGTTTCTGGGGG - Intergenic
919908733 1:202096900-202096922 GTAGCAGGGGTGGTTTCAGCAGG - Intergenic
919933935 1:202239130-202239152 CAACCAGGGTAGGTGTCTTCCGG + Intronic
920305209 1:205014231-205014253 GACCCAGGGTCAGTGTCTGCGGG - Intronic
920431361 1:205921255-205921277 GAACCTGGGTGGGTTCCTGATGG + Intronic
922531835 1:226350724-226350746 GCACCAGGGGTGGCTTCTGCTGG - Intergenic
1064248166 10:13686080-13686102 GTGCCAGGGTTTGTTTATGCTGG - Intronic
1064466882 10:15592372-15592394 GATCCAGGGTGGGGTTTTGCAGG - Intronic
1067472153 10:46545259-46545281 GCCCCAGGGTAGGTTTCTGCTGG - Intergenic
1068980974 10:63061935-63061957 GAACTAGGGTTGGCTTCACCTGG - Intergenic
1069865816 10:71502144-71502166 GAACCAGCCTTGGTGTCTGCAGG - Intronic
1070559292 10:77553699-77553721 GAACCTGGGGTGGGTTCAGCAGG - Intronic
1070728054 10:78805383-78805405 TAACCAGTGTTAGTGTCTGCTGG + Intergenic
1070987112 10:80698599-80698621 TCAGCAGGGTTGGTTTCTCCTGG + Intergenic
1074904459 10:117849080-117849102 GAACACGGGTTTGTTTCTGCAGG - Intergenic
1075817070 10:125272637-125272659 GATCCAGGGTTAGAGTCTGCAGG + Intergenic
1075856222 10:125632288-125632310 GAACCAGGGTTGGTTTCTGCTGG - Intronic
1075979167 10:126722356-126722378 GCACCAGGGTTGCCTTCTGGGGG - Intergenic
1082953463 11:58843503-58843525 AAACCAAGGTTGGTTTTTTCAGG + Intronic
1084764463 11:71299142-71299164 TCATCAGGGTTGGGTTCTGCTGG - Intergenic
1087725449 11:101710778-101710800 GATCCAGGGCTTTTTTCTGCTGG - Intronic
1089891487 11:121885942-121885964 GAGGCAGGGTTGGCATCTGCTGG + Intergenic
1091879511 12:3965580-3965602 GAAACAGTATTGGTTTCTACGGG - Intergenic
1094005113 12:25741061-25741083 GAGCCAGGGTTGGGTTTTACTGG + Intergenic
1095460749 12:42442395-42442417 GATCAAGGGTTGGTTTCTGGAGG - Intronic
1096520443 12:52181804-52181826 GCCCCAGGGTGGGTGTCTGCTGG + Intronic
1097237554 12:57550328-57550350 GAACCAGGCTGAGATTCTGCGGG + Exonic
1098359755 12:69642794-69642816 GAAGCAGGGTTGGTTGGTGCTGG + Intergenic
1098591426 12:72218588-72218610 TCAGCAGGGTTGGTTTCTTCTGG + Intronic
1099156136 12:79178399-79178421 GACACAGGGGTGGTTTCTGGTGG - Intronic
1101414479 12:104497404-104497426 CAAGCAGGGTTGGTTTCTCCTGG - Intronic
1102443119 12:112978650-112978672 GAAGCTGGGTTGGTTTATCCAGG + Exonic
1104612568 12:130241403-130241425 GGACCAGCATTGGGTTCTGCAGG + Intergenic
1106329937 13:28730710-28730732 TCACCAGGGTTGGTTCCTTCTGG + Intergenic
1106393335 13:29356871-29356893 GAACCAGGATTGGTTTCACAAGG + Intronic
1110467475 13:75818526-75818548 GAACCAGCCTAGGTTTCTGGGGG + Intronic
1110736358 13:78941586-78941608 GCAACAGTGTTGGTTTCTTCTGG - Intergenic
1113112468 13:106838475-106838497 GAGGCAGGGCTGGTTTCTCCTGG - Intergenic
1113604869 13:111597950-111597972 GCACCAGGGTGGCTTCCTGCAGG + Intronic
1114752437 14:25219998-25220020 CAACCAGGGCTGCTTTCTCCTGG - Intergenic
1118124010 14:62878773-62878795 TCAGCAGGGTTGGTTTCTTCTGG + Intronic
1118775075 14:68968852-68968874 GTACCAGGGCTGGCTGCTGCTGG + Intronic
1121118155 14:91357960-91357982 GGACCAGGGGTGGCCTCTGCAGG + Intronic
1121328137 14:93033743-93033765 GAACCAGGGAGGGTTTCTCCTGG + Intronic
1121754810 14:96393465-96393487 TCAGCAGGGTTGGTTTCTACTGG + Intronic
1122502307 14:102208884-102208906 GAGCCAGGACGGGTTTCTGCGGG + Exonic
1124017254 15:25887755-25887777 GAGCCAGGGTAAGATTCTGCAGG + Intergenic
1124578354 15:30928740-30928762 GTAACAGAGATGGTTTCTGCTGG - Intronic
1125768282 15:42149397-42149419 TCATCAGGGTTGGTTTCTGCTGG - Intronic
1125788535 15:42344253-42344275 TCATCAGGGTTGGTTTCTTCTGG + Intronic
1126670078 15:51108132-51108154 TAAGCAAGGTAGGTTTCTGCTGG - Intergenic
1129225268 15:74166609-74166631 TCAGCAGGGTTGGTTTCTGCAGG + Intergenic
1132196267 15:99916731-99916753 GAGGCAGGGTTGGTTCCTCCTGG - Intergenic
1134167189 16:11940386-11940408 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1134493517 16:14713327-14713349 GAACGGGGGTTGGTTTATGCTGG - Intronic
1134498897 16:14752451-14752473 GAACGGGGGTTGGTTTATGCTGG - Intronic
1134525450 16:14939072-14939094 GAAAGGGGGTTGGTTTATGCTGG - Intronic
1134546955 16:15117306-15117328 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1134547440 16:15121790-15121812 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1134581670 16:15376564-15376586 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1134713035 16:16337558-16337580 GAAAGGGGGTTGGTTTATGCTGG - Intergenic
1134720904 16:16380918-16380940 GAAAGGGGGTTGGTTTATGCTGG - Intronic
1134946523 16:18330967-18330989 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1134953784 16:18371114-18371136 GAAAGGGGGTTGGTTTATGCTGG + Intergenic
1135312584 16:21417845-21417867 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1135365532 16:21850298-21850320 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1135446307 16:22521038-22521060 GAAAGGGGGTTGGTTTATGCTGG - Intronic
1136322704 16:29498353-29498375 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1136437386 16:30238321-30238343 GAAAGGGGGTTGGTTTATGCTGG + Intronic
1137855356 16:51789466-51789488 GACCCAGGATTGGGTTTTGCTGG - Intergenic
1141129216 16:81423854-81423876 TCAGCAGGGTTGGTTTCTTCTGG + Intergenic
1142903345 17:3026791-3026813 GAACCAGGGTTGAAGTCAGCAGG + Intronic
1146315029 17:31800117-31800139 CCAGCAGGGTTGGTTTCTTCTGG + Intergenic
1147338258 17:39739593-39739615 GAAGCAGAGTTGTTTTCTGTTGG + Intronic
1147599824 17:41738777-41738799 GCACCGGGGTTACTTTCTGCAGG + Intergenic
1147763976 17:42820676-42820698 AATGCAGGCTTGGTTTCTGCAGG - Intronic
1149301682 17:55310164-55310186 GAACCAAGGAGGGTTTCTGGAGG - Intronic
1152203964 17:78963821-78963843 TAACCAGAGGTGGTTTCTGTTGG + Intergenic
1157099454 18:44716119-44716141 CAATCAGGGCTGGTGTCTGCTGG + Intronic
1157183857 18:45521563-45521585 GAAACAGGGTTACTTTCTGAAGG - Intronic
1157376670 18:47173763-47173785 TAAGCAGGGTTGGTTCCTTCTGG + Intronic
1160625780 18:80204004-80204026 GAGCCAGGGTTGGGGTCTGCTGG - Intronic
1161238710 19:3210289-3210311 GAACTAGGGTTGGTCCCTCCTGG + Intergenic
1161725988 19:5929348-5929370 GAGCCAGGGAGTGTTTCTGCTGG - Intronic
1162247316 19:9412659-9412681 GAGACAGGGTTGGTTTCCTCTGG + Exonic
1163486280 19:17588483-17588505 TCAGCAGGGTTGGTTTCTTCTGG + Intergenic
1163713079 19:18858523-18858545 GGACAAAGGTGGGTTTCTGCAGG - Intronic
1164679537 19:30124436-30124458 GCACCAAGGCTGGATTCTGCTGG + Intergenic
925210851 2:2044719-2044741 AAACCAGGGTTGGGTTTTGGGGG - Intronic
925859047 2:8157295-8157317 TCAGCAGGGTTGGTTTCTTCTGG + Intergenic
926055923 2:9773958-9773980 CAAACAGGGTTGGTTCCTCCTGG + Intergenic
926438204 2:12859071-12859093 TTGCCAGGGTTGGTTTCTCCTGG + Intergenic
926910751 2:17850675-17850697 GAGCCAGGGTTGGTGACTACAGG + Intergenic
930852172 2:55972962-55972984 GAATCGGTGTTGGTCTCTGCTGG + Intergenic
935265378 2:101388896-101388918 CAAACAGGTTTGGATTCTGCAGG - Intergenic
935526963 2:104182325-104182347 GATTCAGGGTTGGTTTCTGCTGG - Intergenic
935700703 2:105809400-105809422 TCAGCAGGGTTGGTTTCTTCTGG + Intronic
937029966 2:118730805-118730827 GACCCAGGGTTGGTTTTATCTGG + Intergenic
937850830 2:126634256-126634278 GTACCAGGCTTGGTTTTGGCGGG + Intergenic
942326485 2:174780904-174780926 GAACAAGGGCTGTTTTCAGCAGG + Intergenic
946224594 2:218257462-218257484 GAATAAGGGTTGGCTTCTGTGGG - Intergenic
946872278 2:224094944-224094966 CAACAAAGGTTGGTTTCTCCTGG - Intergenic
947243135 2:228017977-228017999 AAACCAGGGTTGTTTTCCACTGG + Exonic
948528580 2:238588709-238588731 GAGCCAGGGTGGATTTCTGCAGG + Intergenic
948996895 2:241585481-241585503 AAACCTGGGTTGTTATCTGCAGG - Intronic
1172861341 20:38055284-38055306 GAACAAGGGTTGCCTTCTTCTGG + Intronic
1173242530 20:41310146-41310168 GAGCCAGGGTTGGGGTTTGCTGG - Intronic
1174566697 20:51469825-51469847 TCAGCAGGGTTGGTTCCTGCTGG - Intronic
1175608405 20:60330182-60330204 AAACCAGGGTTGGTTCCTTCTGG - Intergenic
1175824174 20:61927710-61927732 GAGCCAGGGAGGGGTTCTGCGGG - Intronic
1176183972 20:63767895-63767917 GCATGAGGGTGGGTTTCTGCAGG - Intronic
1178047542 21:28712174-28712196 CAACCAGGGATCCTTTCTGCTGG - Intergenic
1181439565 22:22928812-22928834 GAAGGAGGGTTGGTCTGTGCTGG + Intergenic
1182416861 22:30226883-30226905 GAGCCACGGTTGGTTTAAGCAGG + Intergenic
1182600919 22:31463045-31463067 GAACCAGAGTGGTTCTCTGCTGG - Exonic
1184351566 22:43947479-43947501 GAACCTGGCTTATTTTCTGCAGG + Exonic
949293127 3:2488487-2488509 TCTCCAGGGTTGGTTCCTGCTGG + Intronic
951864069 3:27287210-27287232 CAGCCAGGCTTGCTTTCTGCAGG - Intronic
951941966 3:28089018-28089040 GAACCAGGCCTGGATTCTGGCGG + Intergenic
953290169 3:41652430-41652452 AGACCTGGGTTTGTTTCTGCAGG + Intronic
953535391 3:43773435-43773457 CCACCAGGGCTGGTCTCTGCAGG - Intergenic
954779988 3:53051712-53051734 GAAGCAGGCCTGTTTTCTGCAGG + Intronic
955062758 3:55507433-55507455 GAACCAGGGGCTGGTTCTGCAGG + Intergenic
957758642 3:84525245-84525267 GAATCAGGGATGGTTTCTGCTGG + Intergenic
958141760 3:89571167-89571189 GACCCAGGGTGGGTATCTGCAGG + Intergenic
959931763 3:111992793-111992815 GAACCAGGTTTACTATCTGCTGG - Exonic
962425337 3:135264430-135264452 GAACCAGGGCTGTGTCCTGCTGG + Intergenic
963009477 3:140755776-140755798 TCAGCAGGGTTGGTTCCTGCTGG + Intergenic
963493639 3:146032785-146032807 GAACAAGTGTTGATTTCTGTAGG - Intergenic
965732134 3:171783336-171783358 TAACCAGGGTTGTGTTTTGCAGG + Intronic
967397814 3:189026162-189026184 CTAACAGGGTTGGTTTCTGATGG + Intronic
970608468 4:17704324-17704346 CAAACAGGGTGGCTTTCTGCTGG - Intronic
970912579 4:21294339-21294361 GAACCAGGCTTTGGTTCAGCAGG - Intronic
971245912 4:24927734-24927756 GAACCAGAGTTGGTGTATGTTGG - Intronic
973728849 4:53803932-53803954 GAACCAGGTTTGGCTTCTTGGGG - Intronic
982775326 4:159435728-159435750 GATCTAGTGTTGGTTTCCGCTGG + Intergenic
984301827 4:177929713-177929735 GACCCTGGGTTTGTTTCTACAGG - Intronic
985253734 4:188048611-188048633 GAAACTGGGATGGTTTCTGGAGG + Intergenic
985703900 5:1389688-1389710 TTGCCAGGGTTGGTTCCTGCTGG + Intergenic
990844094 5:60117771-60117793 GAAAGAGGGTTGGTAGCTGCAGG - Intronic
991684239 5:69167164-69167186 GAACGGCTGTTGGTTTCTGCTGG + Exonic
995786489 5:115835764-115835786 GAAACAGGGTTGGCATCTGACGG - Intronic
997453223 5:134000037-134000059 GAGCTAGGGTTGCCTTCTGCTGG - Intronic
997810115 5:136959112-136959134 GATGGAGGGTTGGTTTCTGCAGG - Intergenic
997863390 5:137439842-137439864 GAATCAGTGTTGGTATCTTCAGG - Intronic
999013820 5:148074139-148074161 GTAGCAGGGTTGATTTCTGATGG - Intronic
1000213426 5:159131277-159131299 GAGGCATGGTTAGTTTCTGCTGG - Intergenic
1002126525 5:177049579-177049601 GAATCAGGGATGTTTTCTGAAGG + Intronic
1002755205 6:152529-152551 CAAACAGGTTTGGTTTCTGAAGG + Intergenic
1004160895 6:13212002-13212024 CCAACAGGGTTGGTTTCTCCTGG + Intronic
1004233800 6:13855427-13855449 TCAGCAGGGTTGGTTTCTTCTGG + Intergenic
1011272778 6:85596041-85596063 GAACCAGGGTTGGTTGATTGTGG - Intronic
1013127114 6:107194978-107195000 CAACCAGGGTTAGTTTTTGCTGG + Intronic
1014572144 6:123022869-123022891 GAACAATGATGGGTTTCTGCAGG + Intronic
1015310603 6:131762795-131762817 GTAGCAGGGCTGGTTTCTTCAGG - Intergenic
1016756435 6:147692868-147692890 TAATCTGGGTTGATTTCTGCAGG - Intronic
1017828231 6:158099392-158099414 GAACCCGGGTTGCTCACTGCAGG - Intergenic
1018868138 6:167761029-167761051 GAATCAGGGTTGGGTTTGGCAGG - Intergenic
1020600014 7:10262771-10262793 GAACCTTAGTTGGATTCTGCTGG - Intergenic
1020639170 7:10734264-10734286 TCAGCAGGGTTGGTTTCTGACGG + Intergenic
1020764203 7:12300621-12300643 GAAACAGGATTGGGTTCTGTAGG + Intergenic
1021651079 7:22833900-22833922 GAGCCAGGGATGATTTCTGATGG + Intergenic
1022035511 7:26530303-26530325 GAGCCAAGGTTTGTTTCTGAGGG + Intergenic
1024332587 7:48170977-48170999 GAAGCAGTGTTGGTGTCTGGGGG - Intergenic
1026020241 7:66700153-66700175 GAACCAGGGCTGGAATGTGCAGG - Intronic
1026880076 7:73902259-73902281 GAACCAGGGCTGGAATGTGCAGG + Intergenic
1027967024 7:85025364-85025386 GAACCAGGGCTGGTTGCTGTTGG - Intronic
1034590892 7:152138062-152138084 GCAGCAGGCTTGGTTTCTGTAGG - Intronic
1035124025 7:156594872-156594894 TCAGCAGGGTTAGTTTCTGCTGG - Intergenic
1036034446 8:5003929-5003951 TAACCAGGGTTGCTGTGTGCTGG + Intergenic
1036213100 8:6858346-6858368 GAAGAAGAGCTGGTTTCTGCAGG - Intergenic
1038401740 8:27289077-27289099 GCACCAGGGCTGGTCTCTGCCGG - Intronic
1042515820 8:69657788-69657810 GAACAAGTGTTATTTTCTGCAGG + Intronic
1043374939 8:79638276-79638298 GAGCCAGGGATGGTTTTTGCTGG + Intronic
1047075130 8:121392639-121392661 GAGGCAGGATTGGTTTCTGGTGG - Intergenic
1049024306 8:139978212-139978234 GTCCCAGGGTGGGGTTCTGCCGG - Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1054747774 9:68872244-68872266 GAACCAAGGTTGTTGCCTGCTGG + Intronic
1056074954 9:83028982-83029004 TCAGCAGGGTTGGTTTCTTCTGG - Intronic
1057308775 9:93928292-93928314 TCAGCAGGGTTGGTTTCTCCTGG + Intergenic
1059470390 9:114500795-114500817 GCACCAGGGTTGGTGTTTGTGGG + Intronic
1189726857 X:43975898-43975920 GAACCAGGCTTGGTTACACCTGG - Intergenic
1190058339 X:47195048-47195070 GAACCCAGGTTGGTTTTTGAAGG - Intronic
1197886335 X:131221998-131222020 GAATCAGGGTGGGTTTCACCAGG + Intergenic
1198438109 X:136636557-136636579 GAACCAGGGTTGGTCTGGGGCGG + Intergenic
1199025591 X:142933354-142933376 GAACCAGGGATTGTATCTTCAGG + Intergenic
1199374090 X:147087358-147087380 TCTCCAGGGTTGGTTTCTGGGGG + Intergenic
1200227138 X:154424446-154424468 GCACCAGGGTGGGTTCCTTCTGG + Intergenic
1201454842 Y:14158751-14158773 AGTCCAGAGTTGGTTTCTGCTGG - Intergenic