ID: 1075856829

View in Genome Browser
Species Human (GRCh38)
Location 10:125637009-125637031
Sequence GTAGAATTATAGGCCTGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075856826_1075856829 24 Left 1075856826 10:125636962-125636984 CCAGTCTTTGATTTTATGAATTT 0: 1
1: 7
2: 25
3: 144
4: 835
Right 1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG No data
1075856825_1075856829 29 Left 1075856825 10:125636957-125636979 CCATTCCAGTCTTTGATTTTATG 0: 1
1: 5
2: 33
3: 76
4: 638
Right 1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075856829 Original CRISPR GTAGAATTATAGGCCTGGTG CGG Intronic
No off target data available for this crispr