ID: 1075856962

View in Genome Browser
Species Human (GRCh38)
Location 10:125637946-125637968
Sequence ATCACCAAGGGGAAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075856962_1075856973 25 Left 1075856962 10:125637946-125637968 CCCTCCAACTTCCCCTTGGTGAT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1075856973 10:125637994-125638016 ACAGGCTGCTCATCTTCCTATGG No data
1075856962_1075856974 26 Left 1075856962 10:125637946-125637968 CCCTCCAACTTCCCCTTGGTGAT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1075856974 10:125637995-125638017 CAGGCTGCTCATCTTCCTATGGG No data
1075856962_1075856971 7 Left 1075856962 10:125637946-125637968 CCCTCCAACTTCCCCTTGGTGAT 0: 1
1: 0
2: 1
3: 17
4: 189
Right 1075856971 10:125637976-125637998 CCTTGAAATGATCATGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075856962 Original CRISPR ATCACCAAGGGGAAGTTGGA GGG (reversed) Intronic
900198177 1:1387990-1388012 AACACCAAGAGGAGGCTGGAGGG - Exonic
900492579 1:2959717-2959739 ATGACCAAGGGGTAGTGTGAAGG + Intergenic
901363255 1:8722256-8722278 ATAGCCAAGGGGAAGGTAGATGG - Intronic
902394627 1:16125897-16125919 ATCAGCAGTGGGAACTTGGAAGG - Intronic
904861376 1:33540650-33540672 ATCCCCAATGGGAAGGTGGTGGG - Exonic
905518698 1:38580970-38580992 AGCACCAAAGGGAAGGTGGGAGG + Intergenic
906460507 1:46032448-46032470 TCCACAAAGGGGAAGCTGGAAGG - Intronic
912103902 1:106246470-106246492 ATCACCTAAAGGAAGTTGGCAGG - Intergenic
913748529 1:121934829-121934851 ATCTGCAAGGGGACATTGGAGGG - Intergenic
914365572 1:146975159-146975181 CTCACTAAGGGTAAGTGGGATGG - Intronic
914823848 1:151126849-151126871 ATCAAGATGGGAAAGTTGGAGGG + Intergenic
915891911 1:159781113-159781135 AGCACCCAGGAGAAGTTGGGGGG - Exonic
917794836 1:178525836-178525858 ACCTCCAAGGGGATGATGGATGG - Intronic
918607165 1:186441838-186441860 ATCAGCAAAGGAAACTTGGAAGG + Intergenic
923103693 1:230837871-230837893 AGCACCAAGAAGAACTTGGAGGG + Exonic
923397573 1:233582293-233582315 ATCACCAAGGGGGTGCTGAAGGG + Intergenic
924371825 1:243359132-243359154 GTCACCAAGAGGAAGGAGGAAGG - Intronic
1064592360 10:16907404-16907426 ATCACTAAAGGGAAAATGGATGG + Intronic
1065740821 10:28795563-28795585 TTCACCAAGGGGAGGAGGGAGGG - Intergenic
1065829347 10:29600284-29600306 ATCACAAAGGGGAAGGTTGGAGG + Intronic
1067009377 10:42695530-42695552 ATCACTAAAGGGAAAATGGATGG + Intergenic
1067314343 10:45147721-45147743 ATCACTAAAGGGAAAATGGATGG - Intergenic
1068762008 10:60722716-60722738 ATCACCAAGGGGATGGTGTTAGG - Intronic
1070841619 10:79491564-79491586 ATCACCAAGAGGAACTAGCATGG - Intergenic
1072339143 10:94429664-94429686 ATAACAGAGGGGAAGTTGGATGG - Intronic
1072752807 10:97995453-97995475 ATCACCAAGAAGACATTGGAGGG - Intronic
1074535358 10:114324994-114325016 CTCACCCTGGGGAAGCTGGAAGG - Intronic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075556135 10:123434000-123434022 ATCACCCAGGGGAGGGTGGGAGG + Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1077059122 11:610044-610066 AGCACCAAGGGGAGGTTGCGAGG - Intronic
1081214159 11:40373677-40373699 ATCACCAAGGGGATGGTGCCAGG - Intronic
1081613753 11:44578697-44578719 ATCAGCAATGGAAAGTTGGTTGG + Intronic
1084274698 11:68045289-68045311 CTCAACAAGGGGGAGTTGGCTGG - Intronic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089166076 11:116477563-116477585 AGCACCAAAGGGTATTTGGATGG + Intergenic
1089399485 11:118156237-118156259 ATGCCCCAGGGGAAGTCGGATGG + Intergenic
1090278912 11:125439565-125439587 ATCACTGGGTGGAAGTTGGAGGG - Intergenic
1092089869 12:5795485-5795507 TTCACCAAGGGGATAATGGATGG - Intronic
1102529785 12:113537829-113537851 ATCACCAAGGGGATGGTGCTAGG + Intergenic
1105209010 13:18247008-18247030 TTCACCAAGGGAGAGTTCGAGGG + Intergenic
1105258286 13:18759687-18759709 ATCACAAACGGGAGGTTGGTAGG - Intergenic
1105260943 13:18778987-18779009 ATCACAAACGGGAGGTTGGTAGG - Intergenic
1106469571 13:30042472-30042494 ATCACCAGAGGGAGGTTGGCAGG - Intergenic
1108135875 13:47358773-47358795 ATCAACAAGGATAAGTTGGTAGG - Intergenic
1108737892 13:53304892-53304914 ATCTGCAATTGGAAGTTGGATGG + Intergenic
1114893584 14:26957459-26957481 TTTACCAAGGGGAAGGTGGTGGG + Intergenic
1115505673 14:34092249-34092271 ATCCCCAAGGGGAAGAGGGTTGG + Intronic
1116070053 14:40032399-40032421 ACCAACAAGGGGAAGTTCAATGG - Intergenic
1117394985 14:55299940-55299962 TTCAGGAGGGGGAAGTTGGAGGG - Intronic
1119872275 14:78028045-78028067 ATCCCCAAGGGGAAGGGAGAGGG - Intergenic
1122320554 14:100852754-100852776 TGCACCAAGAGGAAATTGGAAGG + Intergenic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1126315491 15:47365026-47365048 ATAACAAAAGGGAAGTTGGGAGG + Intronic
1128846073 15:70896422-70896444 ATCAGAATGGGGAAGATGGAGGG - Intronic
1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG + Intergenic
1132373051 15:101311040-101311062 ATCACCAAGGGGATGGTGTGAGG - Intronic
1133654431 16:7846609-7846631 ATCCCCAAGGGGAAGATGGGAGG - Intergenic
1138342354 16:56298376-56298398 ATCAATAAGGGCAAGCTGGAAGG - Intronic
1140348090 16:74234271-74234293 ATCACCAAGGGGATGGTGCTAGG + Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1143570213 17:7753417-7753439 ATGACCAAGGGGGAGTGGGCTGG + Intronic
1143656101 17:8294635-8294657 ATCACCATCGGCAAGGTGGATGG - Exonic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144171594 17:12664521-12664543 ATCCCCAAAGGGAACATGGATGG + Intergenic
1144334765 17:14258771-14258793 ATCACCTGAGGGAACTTGGAAGG - Intergenic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145587826 17:25236792-25236814 ATCTGCAAGTGGACGTTGGAGGG + Intergenic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147309259 17:39584744-39584766 ATGAGCAAGGGGAAGATTGAAGG + Intergenic
1148457528 17:47819077-47819099 ATCACCAAGGGGAAGCTCCATGG - Exonic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148896264 17:50840870-50840892 ATCATCATGGGGGAGGTGGACGG + Exonic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1154432760 18:14321044-14321066 ATCACAAACGGGAGGTTGGTAGG + Intergenic
1155394894 18:25376880-25376902 AACACCAAGAGGAATTTGGCTGG + Intergenic
1155720480 18:29005173-29005195 ACCATAAAGGGGAAGTTGAAAGG - Intergenic
1156403368 18:36760581-36760603 AAAACCAAGGGGAAGTTAGCAGG - Intronic
1157963589 18:52183398-52183420 ATTATCAAGGTGAAATTGGATGG + Intergenic
1158492579 18:57923658-57923680 ATCACCAAGGAGTAGTGAGAGGG - Intergenic
1164662453 19:29988469-29988491 ACCACCAAGGGGCAGTGTGAGGG - Intronic
1202637525 1_KI270706v1_random:55232-55254 ATCACAAACGGGAGGTTGGTAGG - Intergenic
925985812 2:9213788-9213810 TTCACCATGGGGATGCTGGAAGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929099158 2:38292619-38292641 ATCACCAGGTGGAACTTGGTGGG - Intergenic
929329477 2:40663242-40663264 ATCTACATGTGGAAGTTGGAAGG + Intergenic
930858167 2:56041218-56041240 TTCACCAAGGGGAGTTTAGATGG - Intergenic
934012700 2:87841150-87841172 ATCACCAAGGAAATGTTGGTAGG - Intergenic
935588469 2:104823489-104823511 ATCAGCAAGGGGAAGCTAGAAGG - Intergenic
937253366 2:120538177-120538199 AAGACCAAGGGGAAGTTTGTTGG - Intergenic
937393538 2:121514391-121514413 ATCTCTTAGGGAAAGTTGGAGGG - Intronic
937967834 2:127527286-127527308 ATCATCAGCGGGAATTTGGAAGG - Intergenic
939240360 2:139551033-139551055 AGCAACAAGGGAGAGTTGGAGGG - Intergenic
939249693 2:139667853-139667875 GTCACCAATGGGAAGAGGGATGG - Intergenic
939357647 2:141124934-141124956 ACCACAAAGGGAAAGGTGGAAGG - Intronic
941175624 2:162194588-162194610 ACCACCAAGGGGAACTGCGATGG - Intronic
943402697 2:187435378-187435400 ATCACCAAGGGGATGGTGCTAGG + Intronic
944364399 2:198899978-198900000 AACACCAATGGGAAGTTATAGGG - Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
947142149 2:227029294-227029316 GTCACCAAGAGGAAGGAGGAAGG - Intronic
1171290182 20:23978723-23978745 TTCACCAAGGGAGAGTTCGAGGG + Intergenic
1171490951 20:25516795-25516817 ACCAGCAAGAGGAAGTGGGAAGG + Intronic
1171884107 20:30639323-30639345 ATCACAAACGGGAGGTTGGTAGG - Intergenic
1172475854 20:35236995-35237017 ATCACTAAGAGCAAGTTGGTGGG + Intronic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1174416734 20:50372556-50372578 AATGCCAAGGGGAAGATGGAGGG + Intergenic
1174870389 20:54175839-54175861 ATCACCAAGAGGAAAGTGGGGGG + Intergenic
1175414659 20:58793614-58793636 ATGACCAAGGGGACTTTGCAGGG + Intergenic
1176844281 21:13864704-13864726 ATCACAAATGGGAGGTTGGTAGG - Intergenic
1176991198 21:15498217-15498239 ATATCCAAGTGGAAGTTTGAAGG - Intergenic
1177627389 21:23680610-23680632 ATATCCAAGGGAAAATTGGATGG - Intergenic
1180286089 22:10746053-10746075 AGCACCAAGTGGGAGTTGGGGGG - Intergenic
1180767247 22:18352290-18352312 TTCACCAAGGGAGAGTTCGAGGG - Intergenic
1180779062 22:18510089-18510111 TTCACCAAGGGAGAGTTCGAGGG + Intergenic
1180811783 22:18767409-18767431 TTCACCAAGGGAGAGTTCGAGGG + Intergenic
1180874152 22:19166967-19166989 GTCACCAGGGGGAACTGGGATGG - Intergenic
1181017080 22:20076969-20076991 ATCACCTAGAGGATGGTGGAGGG + Intergenic
1181197937 22:21201651-21201673 TTCACCAAGGGAGAGTTGGAGGG + Intergenic
1181401808 22:22654154-22654176 TTCACCAAGGGAGAGTTCGAGGG - Intergenic
1181703763 22:24635247-24635269 TTCACCAAGGGAGAGTTCGAGGG - Intergenic
1183036130 22:35142277-35142299 AGTACCAAGGGGAAGTTGGTTGG - Intergenic
1184300335 22:43555162-43555184 CTCACCCAGGGCAAGTTGCAGGG + Intronic
1203228869 22_KI270731v1_random:93184-93206 TTCACCAAGGGAGAGTTCGAGGG - Intergenic
949200302 3:1370028-1370050 ATTAGCAAGGTGAAGTTGAAGGG - Intronic
950101382 3:10358921-10358943 AGCACCTAGGGGAGGATGGAAGG + Exonic
950924788 3:16729573-16729595 ATCACCTGGGGGATGATGGAGGG + Intergenic
952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG + Intronic
953576682 3:44118245-44118267 TTCACAACAGGGAAGTTGGAAGG + Intergenic
954455962 3:50600021-50600043 AGCACCAAGGGAGAGTAGGAGGG - Intergenic
958491688 3:94782679-94782701 ATAACCAAGTGGATGTTGGAAGG - Intergenic
959359215 3:105367918-105367940 CTCACCAAGGGGAAGTTACTAGG - Intronic
960544018 3:118891341-118891363 ATCAGCACTGTGAAGTTGGAGGG + Intergenic
963433378 3:145237501-145237523 AACACCAAAGGGAAGATGGAAGG - Intergenic
965900685 3:173637729-173637751 AAGACCAATGGGAAGTTGCATGG + Intronic
967099166 3:186201626-186201648 AACACAAAGGGGAAGATGGCTGG - Intronic
968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG + Intronic
971232622 4:24812259-24812281 ATCAACAAAGGGAACTGGGAAGG - Intronic
972329404 4:38050543-38050565 ATCACTAAGGGACACTTGGAAGG - Intronic
973393288 4:49573832-49573854 ATCACAAACGGGAGGTTGGTAGG + Intergenic
979677958 4:123430236-123430258 ATCACCAAGGGGATGGTGCTAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
988028404 5:25729261-25729283 ATCACCTGGGGGATGGTGGAAGG + Intergenic
988393745 5:30669757-30669779 AGCAGGAAGAGGAAGTTGGAAGG + Intergenic
988665541 5:33323458-33323480 ATCACGAAGGGAAAATGGGAGGG - Intergenic
988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG + Intronic
993876533 5:93314105-93314127 ATAACAAAGTGGAAGTGGGAAGG + Intergenic
994456740 5:100018836-100018858 ATAACCAAGGGGAATTGGAAAGG - Intergenic
996713669 5:126568582-126568604 ATCACCTAGAGGAAGTTGTTAGG + Intronic
997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG + Intronic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1001017153 5:168151957-168151979 ATCATCCAGGGCAAATTGGAAGG + Intronic
1004373424 6:15072255-15072277 TTCACTATGGGGATGTTGGAGGG + Intergenic
1006067998 6:31476279-31476301 ATCAGCAAAGGGAAGTTGTTGGG - Intergenic
1006091522 6:31631629-31631651 ATAACCAAGGGGAAGCTAGGGGG + Exonic
1006264168 6:32903348-32903370 ATCACACAGAGGAAGGTGGAAGG - Intergenic
1006415712 6:33902739-33902761 ATCACCAAGAGGAATTAGAATGG + Intergenic
1006503053 6:34470077-34470099 AGCACCCAGGGGAGGGTGGAGGG - Intronic
1011420191 6:87163767-87163789 ATAACCAAAGAGAAGTGGGAGGG + Intronic
1013625076 6:111928849-111928871 ATCACCAAGGGGAGGGGGGTCGG - Intergenic
1013827094 6:114226473-114226495 ATCAACAAGGGGAAGTTAAGTGG - Intronic
1017529756 6:155277681-155277703 ATCACAAACGGGAATTAGGAAGG + Intronic
1017723464 6:157260708-157260730 CTCATCACGGGGAGGTTGGATGG + Intergenic
1023915093 7:44582546-44582568 AGCACCAAGGAGACGGTGGACGG + Intergenic
1024865040 7:53895970-53895992 ATCACAGATGGGAAGATGGATGG - Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1026141339 7:67709588-67709610 ATGACAAGGGTGAAGTTGGAGGG - Intergenic
1028312131 7:89352213-89352235 ATCACCAGGAGGGAGTTAGAAGG + Intergenic
1029529942 7:101118643-101118665 GTCACCAAGGGGAATTTCAATGG - Intergenic
1031054989 7:116983524-116983546 ATCCCCTAGGGGAAGGGGGATGG - Intronic
1031258938 7:119491789-119491811 ATTACTGAGGGGAAGCTGGAGGG + Intergenic
1031682605 7:124692803-124692825 CTTACCAAGAGGAATTTGGATGG + Intergenic
1033896509 7:146077590-146077612 ATAAACATGGGGAAGGTGGAGGG + Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1037677018 8:21059649-21059671 ATCAAGAGGGAGAAGTTGGAAGG - Intergenic
1037953886 8:23038100-23038122 AACACAAAGGGGAAATTGAAGGG + Intronic
1038097043 8:24324956-24324978 TTAATCAAGGGGAAGTTGTAGGG + Intronic
1039911985 8:41833309-41833331 ATCACCACGGGGCACTTGGAAGG - Intronic
1039986030 8:42448686-42448708 ATCACCCAGGGGAAGTGGTGGGG + Intronic
1042655526 8:71091502-71091524 ATCACCAGAGGGAATTTGGTGGG + Intergenic
1049939655 9:533204-533226 AACCCCAAGGGCAATTTGGAGGG + Intronic
1053478073 9:38396298-38396320 ATGACCAAGGGGAAGTTCCACGG - Exonic
1055811820 9:80157524-80157546 GTCAGCAAGGGTAAATTGGATGG + Intergenic
1058768927 9:108211618-108211640 AGCACCAAGGGGAAGGAGGTTGG - Intergenic
1059222730 9:112640362-112640384 ATCACCAAGAGGCAATTGCATGG - Intronic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060771780 9:126337187-126337209 ATTACCAACTGGAAGTTGCAGGG - Intronic
1060823362 9:126673805-126673827 ATCCCCACGGGGAGATTGGATGG + Intronic
1062158133 9:135065468-135065490 TTCCCCAAGGGGAAGCAGGATGG - Intergenic
1203392962 Un_KI270468v1:2515-2537 ATCGGCAAGGGGATGTTGGATGG + Intergenic
1186360707 X:8837919-8837941 ATCACAAAGAGAAAGCTGGAGGG - Intergenic
1187249208 X:17581738-17581760 ACCACGAAGGGGAAGGTGAAAGG - Intronic
1187275175 X:17810668-17810690 AGCACCAAGGAGGAATTGGAGGG + Intronic
1189127598 X:38464323-38464345 ATCACCAAGTGGAATATAGAAGG + Intronic
1190302239 X:49063815-49063837 ACTACCAAGGGTTAGTTGGAAGG - Intronic
1192196378 X:69031518-69031540 ATCACCAAGGGGGATGTGGAGGG + Intergenic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196612054 X:117726719-117726741 ATTACAAATGGAAAGTTGGAAGG - Intergenic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1197415844 X:126171684-126171706 ATCACCAAGTGGAAGTTGTAAGG + Intergenic
1199131776 X:144197338-144197360 ATCACCAAGGAAATGTTGGTAGG + Intergenic
1199893484 X:152111086-152111108 ATCACAAAGTGGAAGTAGCATGG - Intergenic