ID: 1075859018

View in Genome Browser
Species Human (GRCh38)
Location 10:125657737-125657759
Sequence AGTCCAGGAATGGCACCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075859013_1075859018 1 Left 1075859013 10:125657713-125657735 CCACATCTTTGAGCTCCCAGCTG 0: 1
1: 0
2: 1
3: 28
4: 271
Right 1075859018 10:125657737-125657759 AGTCCAGGAATGGCACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075859018 Original CRISPR AGTCCAGGAATGGCACCTAC AGG Intronic
No off target data available for this crispr