ID: 1075860499

View in Genome Browser
Species Human (GRCh38)
Location 10:125671843-125671865
Sequence CATTCTCCCAACACTAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10173
Summary {0: 1, 1: 2, 2: 103, 3: 3936, 4: 6131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075860499 Original CRISPR CATTCTCCCAACACTAAATC AGG (reversed) Intronic
Too many off-targets to display for this crispr