ID: 1075861446

View in Genome Browser
Species Human (GRCh38)
Location 10:125680206-125680228
Sequence CTGAGTCAACACTTCCCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075861440_1075861446 6 Left 1075861440 10:125680177-125680199 CCTTTTCCTTCACCCTTCCTCCA 0: 1
1: 1
2: 12
3: 153
4: 1236
Right 1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG No data
1075861442_1075861446 -6 Left 1075861442 10:125680189-125680211 CCCTTCCTCCAGTCTGACTGAGT 0: 1
1: 1
2: 1
3: 23
4: 208
Right 1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG No data
1075861443_1075861446 -7 Left 1075861443 10:125680190-125680212 CCTTCCTCCAGTCTGACTGAGTC 0: 1
1: 0
2: 0
3: 29
4: 251
Right 1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG No data
1075861441_1075861446 0 Left 1075861441 10:125680183-125680205 CCTTCACCCTTCCTCCAGTCTGA 0: 1
1: 0
2: 1
3: 27
4: 383
Right 1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075861446 Original CRISPR CTGAGTCAACACTTCCCTCT CGG Intronic
No off target data available for this crispr