ID: 1075861834

View in Genome Browser
Species Human (GRCh38)
Location 10:125683765-125683787
Sequence GGATGCCACAAGTCCCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075861828_1075861834 24 Left 1075861828 10:125683718-125683740 CCTTCAACATTTACAAATAGGAA No data
Right 1075861834 10:125683765-125683787 GGATGCCACAAGTCCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075861834 Original CRISPR GGATGCCACAAGTCCCAGCA AGG Intergenic
No off target data available for this crispr