ID: 1075862146

View in Genome Browser
Species Human (GRCh38)
Location 10:125686001-125686023
Sequence TGGTAGGGATAGAGCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075862146_1075862152 -10 Left 1075862146 10:125686001-125686023 CCCCCCAGGCTCTATCCCTACCA No data
Right 1075862152 10:125686014-125686036 ATCCCTACCAGGCCAGAATTTGG No data
1075862146_1075862155 -6 Left 1075862146 10:125686001-125686023 CCCCCCAGGCTCTATCCCTACCA No data
Right 1075862155 10:125686018-125686040 CTACCAGGCCAGAATTTGGAAGG No data
1075862146_1075862157 -4 Left 1075862146 10:125686001-125686023 CCCCCCAGGCTCTATCCCTACCA No data
Right 1075862157 10:125686020-125686042 ACCAGGCCAGAATTTGGAAGGGG No data
1075862146_1075862156 -5 Left 1075862146 10:125686001-125686023 CCCCCCAGGCTCTATCCCTACCA No data
Right 1075862156 10:125686019-125686041 TACCAGGCCAGAATTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075862146 Original CRISPR TGGTAGGGATAGAGCCTGGG GGG (reversed) Intergenic
No off target data available for this crispr