ID: 1075864586

View in Genome Browser
Species Human (GRCh38)
Location 10:125706705-125706727
Sequence ACATGGTTCTTCCTCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075864582_1075864586 8 Left 1075864582 10:125706674-125706696 CCAGGAAGAGGTATAAAGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1075864586 10:125706705-125706727 ACATGGTTCTTCCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1075864581_1075864586 9 Left 1075864581 10:125706673-125706695 CCCAGGAAGAGGTATAAAGGAAG 0: 1
1: 0
2: 2
3: 33
4: 310
Right 1075864586 10:125706705-125706727 ACATGGTTCTTCCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1075864579_1075864586 19 Left 1075864579 10:125706663-125706685 CCAAGGAGGTCCCAGGAAGAGGT 0: 1
1: 0
2: 2
3: 43
4: 302
Right 1075864586 10:125706705-125706727 ACATGGTTCTTCCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075864586 Original CRISPR ACATGGTTCTTCCTCCCTGT GGG Intergenic