ID: 1075870113

View in Genome Browser
Species Human (GRCh38)
Location 10:125766059-125766081
Sequence TCAAACCCAGTGGTAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075870113_1075870119 22 Left 1075870113 10:125766059-125766081 CCCAGAGCTACCACTGGGTTTGA No data
Right 1075870119 10:125766104-125766126 TGAACTTTGGCTAATATGACTGG No data
1075870113_1075870118 9 Left 1075870113 10:125766059-125766081 CCCAGAGCTACCACTGGGTTTGA No data
Right 1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075870113 Original CRISPR TCAAACCCAGTGGTAGCTCT GGG (reversed) Intergenic
No off target data available for this crispr