ID: 1075870118

View in Genome Browser
Species Human (GRCh38)
Location 10:125766091-125766113
Sequence GGATACAAACAGATGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075870114_1075870118 8 Left 1075870114 10:125766060-125766082 CCAGAGCTACCACTGGGTTTGAC No data
Right 1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG No data
1075870113_1075870118 9 Left 1075870113 10:125766059-125766081 CCCAGAGCTACCACTGGGTTTGA No data
Right 1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG No data
1075870116_1075870118 -1 Left 1075870116 10:125766069-125766091 CCACTGGGTTTGACTTTTGGCAG No data
Right 1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075870118 Original CRISPR GGATACAAACAGATGAACTT TGG Intergenic
No off target data available for this crispr