ID: 1075871655

View in Genome Browser
Species Human (GRCh38)
Location 10:125775576-125775598
Sequence GCGCACGCGCGCACAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075871655_1075871661 8 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871661 10:125775607-125775629 GTGTGCACGTGCACGGGCCTGGG 0: 1
1: 0
2: 8
3: 15
4: 136
1075871655_1075871657 1 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871657 10:125775600-125775622 TGTGCCTGTGTGCACGTGCACGG 0: 1
1: 0
2: 9
3: 91
4: 486
1075871655_1075871658 2 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871658 10:125775601-125775623 GTGCCTGTGTGCACGTGCACGGG 0: 1
1: 0
2: 11
3: 43
4: 307
1075871655_1075871662 9 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871662 10:125775608-125775630 TGTGCACGTGCACGGGCCTGGGG 0: 1
1: 0
2: 2
3: 6
4: 154
1075871655_1075871663 10 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871663 10:125775609-125775631 GTGCACGTGCACGGGCCTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 148
1075871655_1075871660 7 Left 1075871655 10:125775576-125775598 CCTGTGCCTGTGCGCGCGTGCGC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075871660 10:125775606-125775628 TGTGTGCACGTGCACGGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075871655 Original CRISPR GCGCACGCGCGCACAGGCAC AGG (reversed) Intronic