ID: 1075879463

View in Genome Browser
Species Human (GRCh38)
Location 10:125837957-125837979
Sequence CTGTCCTTCTTAAAGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075879461_1075879463 23 Left 1075879461 10:125837911-125837933 CCTCTCAAGGTCAATGCACCTGT 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG No data
1075879462_1075879463 5 Left 1075879462 10:125837929-125837951 CCTGTATACAGTGCATTTCTCTA 0: 1
1: 0
2: 0
3: 25
4: 242
Right 1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075879463 Original CRISPR CTGTCCTTCTTAAAGACACA TGG Intronic
No off target data available for this crispr