ID: 1075879463 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:125837957-125837979 |
| Sequence | CTGTCCTTCTTAAAGACACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075879461_1075879463 | 23 | Left | 1075879461 | 10:125837911-125837933 | CCTCTCAAGGTCAATGCACCTGT | 0: 1 1: 0 2: 1 3: 8 4: 123 |
||
| Right | 1075879463 | 10:125837957-125837979 | CTGTCCTTCTTAAAGACACATGG | No data | ||||
| 1075879462_1075879463 | 5 | Left | 1075879462 | 10:125837929-125837951 | CCTGTATACAGTGCATTTCTCTA | 0: 1 1: 0 2: 0 3: 25 4: 242 |
||
| Right | 1075879463 | 10:125837957-125837979 | CTGTCCTTCTTAAAGACACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075879463 | Original CRISPR | CTGTCCTTCTTAAAGACACA TGG | Intronic | ||
| No off target data available for this crispr | |||||