ID: 1075883959

View in Genome Browser
Species Human (GRCh38)
Location 10:125880744-125880766
Sequence AATCCCTGGATTCCAGCGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075883959_1075883963 1 Left 1075883959 10:125880744-125880766 CCCATCGCTGGAATCCAGGGATT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1075883963 10:125880768-125880790 AGGAAAATAGCGTTTTTCAGAGG 0: 1
1: 0
2: 3
3: 18
4: 245
1075883959_1075883964 11 Left 1075883959 10:125880744-125880766 CCCATCGCTGGAATCCAGGGATT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1075883964 10:125880778-125880800 CGTTTTTCAGAGGAAGAGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075883959 Original CRISPR AATCCCTGGATTCCAGCGAT GGG (reversed) Exonic
902976517 1:20092550-20092572 AACCCCTGGATTCCAGCTGAGGG + Intergenic
904874477 1:33643738-33643760 GATCCCTGGATTCCTGGAATGGG - Intronic
905830913 1:41066667-41066689 GATCACTTGATTCCAGGGATGGG - Intronic
907189922 1:52640011-52640033 AATTCCTGGACTCAAGTGATCGG + Intronic
911554321 1:99324675-99324697 AATACCTGGGTTCCAGCTCTAGG + Intergenic
913502349 1:119482873-119482895 AATCCCTGGTTTCCAGGAACTGG + Intergenic
913533812 1:119752486-119752508 AATCCCTGGCTCCCAGCTACTGG + Intronic
916160483 1:161907399-161907421 ATCCACTGGATTCCAGAGATGGG - Intronic
918759933 1:188391215-188391237 AATCCCTTGATCCCAGCAAGTGG + Intergenic
919101865 1:193105551-193105573 ACTCGCTGGAATCCAGCGCTCGG - Exonic
1068128731 10:52871488-52871510 GATCCCTGGGTTCCCGAGATAGG - Intergenic
1071022099 10:81069743-81069765 CATCCCTGGATTCTAGCGCTTGG - Intergenic
1071128585 10:82365244-82365266 CATCCCTGAATTCCATCGACAGG + Intronic
1071495383 10:86164313-86164335 ATTCCCAGGATGCCAGCGCTGGG + Intronic
1073675923 10:105646983-105647005 ACTGCCTGGATTCCACAGATGGG + Intergenic
1074948715 10:118306574-118306596 AATCCCTGGAACACAGCTATAGG - Exonic
1075675397 10:124292611-124292633 AATTCCTGGACTCAAGTGATTGG - Intergenic
1075883959 10:125880744-125880766 AATCCCTGGATTCCAGCGATGGG - Exonic
1076196191 10:128520047-128520069 CATCCCTGGATTCCTGACATGGG - Intergenic
1077451282 11:2647988-2648010 AACTCCTGGACTCAAGCGATCGG - Intronic
1078489160 11:11753369-11753391 CCTCCCAGGATTCCATCGATTGG + Intergenic
1079011487 11:16832210-16832232 TAACCCTGGATTCCTGCTATGGG + Intronic
1080349870 11:31370951-31370973 AATACCTGGATTCCTGCCACTGG - Intronic
1085625373 11:78067805-78067827 AATTCCTGGATTCCAGTCACTGG + Exonic
1086408053 11:86516263-86516285 AAACCCTGGATTCCATAGGTAGG - Intronic
1088002931 11:104904420-104904442 AATTCCTGGACTCAAGCAATTGG + Intergenic
1091509500 12:1107712-1107734 AGTCCCTGGATGGCAGCAATGGG + Intronic
1093594530 12:20945086-20945108 AATTCCTGGATTCCAGAAATTGG - Intergenic
1096550581 12:52369416-52369438 CATCCCTGTATCCCAGCAATAGG - Intergenic
1100835396 12:98562265-98562287 AATTCCTGGACTCAAGTGATCGG + Intergenic
1101471086 12:104998106-104998128 AATCCTTAGATTCCACGGATTGG + Intronic
1102694375 12:114786750-114786772 AATCCCTGCATTGCAGTGAGAGG + Intergenic
1104979664 12:132568159-132568181 AATCCCAGGATCCCAGCGCCAGG - Intronic
1106890179 13:34236302-34236324 AATCTATGCATTCCAGGGATGGG + Intergenic
1108359290 13:49654425-49654447 AACCCCTGGGTTCAAGCAATAGG - Intergenic
1109357175 13:61246554-61246576 ATTCCTTGGATTCCATGGATTGG + Intergenic
1117381725 14:55171181-55171203 AATCCCAGGATTATAGTGATGGG + Intronic
1123213904 14:106788366-106788388 AATCCCTTGAATCCAGGGGTTGG + Intergenic
1125875415 15:43140020-43140042 AATCCCTGGCTTCAAAGGATGGG + Intronic
1129495907 15:75980265-75980287 AATGTCTGGACTCCAGAGATAGG + Intronic
1132091855 15:98953817-98953839 CAAACCAGGATTCCAGCGATGGG - Intronic
1133464728 16:6018935-6018957 CAGCCCTGGATTCCAGCGGGCGG - Intergenic
1134138365 16:11695807-11695829 AAGCCCTGGGCTCAAGCGATCGG - Intronic
1135867568 16:26118288-26118310 AATTCCTGGGTTCAAGCAATGGG + Intronic
1138585514 16:57967468-57967490 AACTCCTGGATTCAAGCAATCGG - Intronic
1139369923 16:66460576-66460598 GATACCAGGATTCCAGAGATGGG - Intronic
1140523621 16:75603601-75603623 AATCCCTGGACTCCTGCCATGGG + Intronic
1141078313 16:81029022-81029044 AATCCCTGGAAACCAGCCACTGG - Intronic
1144626131 17:16845290-16845312 AAGGCCTGGAGTCCAGCCATAGG - Intergenic
1144880303 17:18427430-18427452 AAGGCCTGGAGTCCAGCCATAGG + Intergenic
1145151930 17:20516957-20516979 AAGGCCTGGAGTCCAGCCATAGG - Intergenic
1147231182 17:39019374-39019396 AATGCCTGGCTTCAAGGGATAGG + Intergenic
1147251205 17:39153464-39153486 AACTCCTGGACTCAAGCGATGGG + Intronic
1147580274 17:41623987-41624009 AAGGCCTGGAGTCCAGCCATAGG - Intronic
1148452329 17:47787700-47787722 AACCCCTGGACTCAAGCAATCGG - Intergenic
1158920299 18:62185173-62185195 CATTCCTGGATTCCAGAAATTGG + Intronic
1162126736 19:8503521-8503543 CCTCCCTGGAGTCCAGAGATGGG - Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
925356087 2:3242320-3242342 AATCTCTGTCTTCCAGCCATCGG - Intronic
925356120 2:3242475-3242497 AATCTCTGTCTTCCAGCCATCGG - Intronic
931327037 2:61237314-61237336 AAACTCTGGATTCCAGCCATGGG + Intronic
933241950 2:79931841-79931863 AATCCCTGGATTCCCATGTTTGG - Intronic
935235997 2:101138768-101138790 AATCCCTGGACTCTAGGGTTTGG - Intronic
936506872 2:113115234-113115256 AATCCCTTCATTCCAGCCAGGGG - Intronic
937244710 2:120485197-120485219 ACTTCCTGGATTCCAGAGCTTGG - Intergenic
938136883 2:128766176-128766198 AATCTGTGGATTCCAGAGTTGGG + Intergenic
938542331 2:132294492-132294514 AATGCCAGCATTCCAGGGATGGG + Intergenic
940133860 2:150414034-150414056 CATCCCTGAATTCCAGCCAGTGG + Intergenic
940832196 2:158479445-158479467 AAATCCTGGACTCAAGCGATCGG + Intronic
943122988 2:183760653-183760675 TATCCCTGGATCACAGCTATAGG + Intergenic
943222284 2:185124850-185124872 AAGCCCTGGATTCAAGCTATAGG + Intergenic
943945643 2:194059799-194059821 AATCTATGGATACCAGAGATAGG - Intergenic
945812132 2:214561550-214561572 AACTCCTGGATTCGAGCAATTGG - Intronic
946400132 2:219464271-219464293 CATCCCTGGTTTCCAGGGCTAGG - Intronic
947007469 2:225528757-225528779 AACCCCTGGATTGTAGGGATTGG + Intronic
947225075 2:227832054-227832076 AATCCCTGGATTGTAGCTATTGG - Intergenic
1171871210 20:30527335-30527357 AATGCCAGCATTCCAGGGATGGG + Intergenic
1172496994 20:35394545-35394567 AATCACTGGGTACCAGTGATTGG - Intronic
1173254715 20:41386206-41386228 AACTCCTGGACTCAAGCGATCGG + Intergenic
1174012252 20:47459462-47459484 ACTCCCTGACGTCCAGCGATTGG + Intergenic
1175296238 20:57910627-57910649 AATCCCTGGGTTTCAGGAATCGG - Intergenic
1175356884 20:58375522-58375544 AATCCCTGAATGCCAGAGCTAGG - Intergenic
1180627971 22:17207332-17207354 AAGCCCTGGAGTCCTGGGATGGG - Intronic
1181785184 22:25221661-25221683 AATCCCAGCATGCCAGCTATGGG - Intronic
1183602058 22:38845371-38845393 AATCCCTGGCTCCTAGAGATGGG - Intergenic
1183930624 22:41234119-41234141 CATCCCAGGATCCCAGGGATGGG - Intronic
1184263454 22:43332981-43333003 AGTCCCTAGCTTCCAGGGATGGG + Intronic
950795368 3:15506078-15506100 AACCCTTGGATTCCAGAAATTGG + Intronic
950875292 3:16265570-16265592 AATCCCTGCCTTCCAGGGCTTGG - Intronic
950890659 3:16401086-16401108 AATTCCTGGGCTCAAGCGATCGG - Intronic
952611914 3:35220257-35220279 AATCTCTGCATTACAGAGATAGG + Intergenic
953550533 3:43898975-43898997 AATCAGTGGTTTCCAGAGATTGG - Intergenic
953990439 3:47479015-47479037 AATCCCGGGATTACAGCGGGTGG - Intergenic
963056650 3:141191574-141191596 CATCCCTGGATTCCAGTGTCTGG + Intergenic
970475353 4:16416747-16416769 AATCACTGGACTCCAAGGATGGG - Intergenic
976780872 4:88757717-88757739 AAGCCCTGGATGCCAGAAATGGG + Intronic
977028222 4:91848132-91848154 AATTCCTGGTTTCCAGTGATGGG + Intergenic
984135442 4:175932004-175932026 AATTCCTGGGTTCAAGTGATTGG - Intronic
984556127 4:181216141-181216163 CATCCCTGGATTTCACCCATTGG + Intergenic
989235905 5:39148251-39148273 AATTCCTGGATTCATGTGATTGG + Intronic
994202170 5:96989866-96989888 AATCATTGTATTCCAGAGATGGG + Intronic
1001110193 5:168889406-168889428 ATTCCCTGGATCCCTGAGATAGG - Intronic
1002157437 5:177294288-177294310 AATCCTTGGTTTCCAGCCAGAGG + Exonic
1003422740 6:5973252-5973274 AAATCCTGGAGGCCAGCGATGGG + Intergenic
1005282214 6:24286367-24286389 AAGTCCTGGGCTCCAGCGATCGG - Intronic
1007402964 6:41614975-41614997 GAGCCCTGGATTGCAGCCATGGG - Intergenic
1010615089 6:78002861-78002883 AATTCCTGGGTTCAAGCGATTGG + Intergenic
1012251893 6:96990001-96990023 AATCCTTGGATTCCTTGGATTGG + Intronic
1014576027 6:123073930-123073952 AATTCCTGGTTTCCATTGATGGG + Intergenic
1017418678 6:154249621-154249643 AGTCCCTGGAGGGCAGCGATGGG + Intronic
1018391518 6:163345075-163345097 CATCCCTGGATTCCTCCAATGGG - Intergenic
1018398606 6:163400703-163400725 AATCACTGTATTCCAGGCATAGG + Intergenic
1020633851 7:10672474-10672496 AATCCGTGCATTCCAGGGTTGGG + Intergenic
1023055942 7:36290225-36290247 ACTCCCTGGATACCAGGGGTGGG - Intronic
1029665008 7:101989428-101989450 AATCCCTGGATTTCTCAGATGGG + Intronic
1040468538 8:47717176-47717198 AAGCCCTGGAAGCGAGCGATGGG - Intronic
1041015267 8:53586903-53586925 AATCACTGAATTCCAGTGCTGGG - Intergenic
1042402787 8:68369253-68369275 AATCACTGTATTCCTGCGTTTGG + Intronic
1042461697 8:69076666-69076688 CCTCCCTGGATTTCAGCAATAGG + Intergenic
1044510808 8:93076245-93076267 AATCCCTGTCTTCCAGAGTTTGG - Intergenic
1045416401 8:101972045-101972067 AATCCGTGGATTCCTGTGAGAGG - Intronic
1046942163 8:119941832-119941854 AAACCCTGGTTTCCAGCTCTAGG + Intronic
1047497096 8:125416200-125416222 CATCCCTAAATTCCAGCAATTGG + Intergenic
1050037050 9:1447792-1447814 AGTCCTTGGATTCCAACCATAGG - Intergenic
1051829782 9:21262919-21262941 AAGCCCTGGAGTCCAAAGATCGG - Intergenic
1052791152 9:32876706-32876728 AATCACTGGATCCCAACCATGGG + Intergenic
1059202329 9:112429866-112429888 AACTCCTGGGCTCCAGCGATCGG - Intronic
1186081197 X:5934592-5934614 AATCTCTTGATTTCAGCCATGGG + Intronic
1186468289 X:9801727-9801749 AATTCCTGGGCTCAAGCGATTGG - Intronic
1187348943 X:18494137-18494159 AACTCCTGGAGTCAAGCGATTGG + Intronic
1187450803 X:19394495-19394517 AATCCCTGAATGCAAGAGATAGG - Intronic
1189000592 X:36940226-36940248 AAGGCCTGTATTCCAGTGATTGG - Intergenic
1191162597 X:57347474-57347496 ATTCCCTGGATTCCTTGGATTGG + Intronic
1193196472 X:78638541-78638563 GATCCCTGGATTCCTTGGATTGG + Intergenic
1198609857 X:138385958-138385980 AATCCCTGGAATGCAGCTAAAGG + Intergenic