ID: 1075884568

View in Genome Browser
Species Human (GRCh38)
Location 10:125887127-125887149
Sequence TAGATTATGAATGATATCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075884568_1075884571 30 Left 1075884568 10:125887127-125887149 CCATCGATATCATTCATAATCTA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1075884571 10:125887180-125887202 TCCTCAATGCCTCCATTTTTGGG No data
1075884568_1075884570 29 Left 1075884568 10:125887127-125887149 CCATCGATATCATTCATAATCTA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1075884570 10:125887179-125887201 ATCCTCAATGCCTCCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075884568 Original CRISPR TAGATTATGAATGATATCGA TGG (reversed) Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
909111239 1:71480429-71480451 AAGATTATAAATGCTATCTAAGG - Intronic
921436017 1:215123039-215123061 AAGATTATGAATGTTTTCGGTGG - Intronic
922328443 1:224552400-224552422 GATATTATGAATAATATCAAAGG + Intronic
922328486 1:224552951-224552973 GATATTATGAATGATATCACAGG + Intronic
923782619 1:237038656-237038678 TACATTACGAATGATGACGATGG - Intergenic
1064395363 10:14977523-14977545 AAGATTACAAATAATATCGAAGG - Intronic
1064396302 10:14984572-14984594 GATATTATGAATAATATCAAAGG - Intronic
1064396729 10:14988504-14988526 TATATTATGAATAATATCACAGG - Intergenic
1064399523 10:15009903-15009925 TATATTATGAATAATATCACAGG - Intergenic
1064399565 10:15010446-15010468 GAGATTATGAATAATATCACAGG - Intergenic
1067514788 10:46929430-46929452 AAGATTGTGAAAGATATTGAGGG - Intronic
1067647467 10:48122383-48122405 AAGATTGTGAAAGATATTGAGGG + Intergenic
1068088251 10:52401197-52401219 TGGATTATAAATGATTTGGAGGG + Intergenic
1068368775 10:56086930-56086952 TAGATTGTGAATATTATCCATGG - Intergenic
1070980722 10:80644565-80644587 AAGATTATGAAGGATTTCTATGG + Exonic
1075884568 10:125887127-125887149 TAGATTATGAATGATATCGATGG - Intronic
1077576683 11:3389000-3389022 AAGATTACAAATAATATCGAAGG - Intergenic
1077576718 11:3389356-3389378 TAGATTACGAATGATATCACAGG - Intergenic
1077604741 11:3601673-3601695 TATATTATGAATAATATCACAGG - Intergenic
1080987426 11:37485604-37485626 TAAATTAAGAATGATAACGCAGG + Intergenic
1081051361 11:38345547-38345569 TGGACTATGAATCATATGGAAGG - Intergenic
1082124953 11:48421731-48421753 AAAATTATTAATTATATCGAGGG + Intergenic
1082216826 11:49581320-49581342 TAGACTATGAATCATACTGAAGG - Intergenic
1082251093 11:49980990-49981012 AAAATTATTAATTATATCGAGGG - Intergenic
1082558615 11:54592970-54592992 AAAATTATTAATTATATCGAGGG + Intergenic
1082937120 11:58666684-58666706 AATATTATGAATAATATCAAGGG + Intronic
1084227207 11:67724486-67724508 TATATTATGAATAATATCACAGG - Intergenic
1084228624 11:67733784-67733806 AAGATTACAAATAATATCGAAGG - Intergenic
1084260640 11:67976258-67976280 TATATTATGAATAATATCACAGG - Intergenic
1084807992 11:71592362-71592384 TACATTATGAATAATATCACAGG + Intronic
1084812138 11:71618977-71618999 TATATTATGAATAATATCACAGG + Intergenic
1085625562 11:78069391-78069413 TCTATAATGAATGATATAGAAGG - Exonic
1086441188 11:86831193-86831215 GATATTATGAATAATATCGCAGG - Intronic
1087308314 11:96509472-96509494 TACATTATGAATCATAAGGAAGG - Intergenic
1087528069 11:99343447-99343469 TAGACTAGGTATGATATCCAAGG + Intronic
1092431896 12:8416809-8416831 TATATTATGAATAATATCACCGG - Intergenic
1092433315 12:8426219-8426241 GAGATTACGAATGATATCACAGG - Intergenic
1092434849 12:8439425-8439447 TATATTATGAATAATATCAGAGG - Intergenic
1092554025 12:9536546-9536568 TAGAATATGAAAGGTATCGTGGG + Intergenic
1094518072 12:31154081-31154103 TAGAATATGAAAGGTATCGTGGG - Intergenic
1096508269 12:52110980-52111002 TATATTATGAATAATATCAAAGG + Intergenic
1096862117 12:54536920-54536942 TAGGTTATTATTGATATAGATGG - Intronic
1099028430 12:77494804-77494826 TAAATCATGTATGATATAGATGG - Intergenic
1099179286 12:79459014-79459036 GAGATTATGAATAATATCTCAGG - Intergenic
1099179302 12:79459140-79459162 GATATTATGAATGATATCACAGG - Intergenic
1099179595 12:79461667-79461689 GATATTATGAATAATATCCAGGG - Intergenic
1100117352 12:91323500-91323522 TGAATTATGAATGTTATGGATGG + Intergenic
1104683646 12:130769725-130769747 CAAATGATGAATGATATAGATGG - Intergenic
1107544113 13:41420996-41421018 GATATTATGAATGATATCACAGG + Intergenic
1107544148 13:41421352-41421374 AAGATTACAAATAATATCGAAGG + Intergenic
1107547407 13:41446409-41446431 TATATTATGAATAATATCAAAGG + Intergenic
1107547870 13:41450778-41450800 AAGATTACAAATAATATCGAAGG + Intergenic
1108873695 13:55018702-55018724 TAGATTTTAAATGATATCACAGG + Intergenic
1109481946 13:62966385-62966407 TAGATTATGAATGTTATGGTGGG + Intergenic
1114712648 14:24794197-24794219 TTGATTTTGAATGACAACGAAGG + Intergenic
1116134533 14:40904519-40904541 TAGAATATGAATGATTTTCATGG + Intergenic
1116601618 14:46931943-46931965 TAGAATATCAAAAATATCGATGG + Intronic
1118117155 14:62792639-62792661 TATAATATGAACGATATCGTAGG - Intronic
1120459620 14:84778243-84778265 TATATTCTTAATGATATCAATGG - Intergenic
1122289695 14:100673730-100673752 TAAATTATGAATGGTATTGGAGG - Intergenic
1123206258 14:106716135-106716157 GAGAATATGAAGGATATGGATGG - Intergenic
1123211340 14:106763544-106763566 GAGAATATGAAGGATATGGATGG - Intergenic
1124099470 15:26679924-26679946 CAGATTATGAAAGAAATAGAGGG - Intronic
1130750443 15:86706135-86706157 TGGATTATGAATACTATTGAAGG + Intronic
1133991908 16:10714576-10714598 TATATTATAAATAATATCGCTGG + Intergenic
1134312170 16:13084870-13084892 CAGCTTATGAATGATTTCCAAGG + Intronic
1136662436 16:31775550-31775572 AAGATGTTGAATGTTATCGAAGG - Intronic
1138101957 16:54259266-54259288 AAGAATAAGAATGATATCTATGG + Intronic
1143804005 17:9410364-9410386 TAGATAATGAATGTTAAGGAAGG - Intronic
1145356842 17:22166367-22166389 TAGATTATGAATGTTATGGTGGG - Intergenic
1153074421 18:1146492-1146514 TAGATTATGAAAGATAATAAAGG - Intergenic
1156972637 18:43175183-43175205 TAGATTGTGAATGATACCCAGGG - Intergenic
1158458905 18:57630652-57630674 TATATTTTAAATGAGATCGAGGG + Intergenic
1158826384 18:61224810-61224832 TAGAGTATTAATGATAGAGATGG + Intergenic
1159865493 18:73699739-73699761 TATATTTTGAATGGTATAGATGG + Intergenic
1162229845 19:9257213-9257235 GAGATTATGAATAATATCACAGG - Intergenic
1162229977 19:9258518-9258540 GATATTATGAATAATATCAAGGG - Intergenic
1162230029 19:9259061-9259083 GATATTACGAATGATATCAAAGG - Intergenic
932348633 2:71013425-71013447 TATATTACGAATAATATCAAAGG + Intergenic
932348850 2:71015612-71015634 GATATTATGAATAATATCAAGGG + Intergenic
932349073 2:71017469-71017491 GATATTATGAATGATATCACAGG + Intergenic
932350568 2:71027831-71027853 TATATTATGAATAATATCACAGG + Intergenic
932354071 2:71054086-71054108 TATATTATGAATAATATCACAGG + Intergenic
934590472 2:95545401-95545423 TATATTATGAATAATATCACAGG + Intergenic
934739761 2:96711751-96711773 TAGATAATGATGGATATTGATGG - Exonic
935534824 2:104282149-104282171 TAGATTTTGAATATTATCAAAGG + Intergenic
939143657 2:138386597-138386619 TACATTATGAAAGATATCTTGGG + Intergenic
940233925 2:151489250-151489272 GATATTATGAATGAGATCCAGGG + Intronic
940870099 2:158852541-158852563 TATATTATGAATCATATCACAGG + Intronic
940872809 2:158873599-158873621 TATATTATGAATAATATCACAGG + Intergenic
943767912 2:191682050-191682072 TATATTATAAATAATATCTACGG + Intronic
945364434 2:208934133-208934155 TTGATGATCAATGATATTGAGGG + Intergenic
945528993 2:210926552-210926574 AAGATTGTGAATGATAATGATGG + Intergenic
945572842 2:211491737-211491759 TAAATCATGAATGAGATCAATGG + Intronic
1175476351 20:59277408-59277430 TAGATCATGAAAGATTTCCAAGG - Intergenic
1179671267 21:42950546-42950568 GAGATTACGAATGATATCACAGG - Intergenic
1182385272 22:29934016-29934038 TATATTATGTATAATATCTATGG + Intronic
949886646 3:8700458-8700480 GATATTATGAATGATATCACAGG + Intronic
949886687 3:8700815-8700837 CAGATTACAAATAATATCGAAGG + Intronic
951378466 3:21952829-21952851 TAGTTTATGTATGATATAAAAGG - Intronic
952112282 3:30137937-30137959 TGTATTATGAATAATATCAAAGG - Intergenic
955203147 3:56869982-56870004 TAAATTATGCATGACATAGAAGG + Intronic
957043788 3:75358526-75358548 TATATTATGAATAATATCACAGG - Intergenic
957045208 3:75368522-75368544 AAGATTACAAATAATATCGAAGG - Intergenic
959260040 3:104066718-104066740 CAGACTATGAATAATATAGATGG + Intergenic
961270908 3:125687684-125687706 TATATTACGAATAATATCAATGG + Intergenic
961272852 3:125702280-125702302 TATATTATGAATAATATCACAGG + Intergenic
961275597 3:125723450-125723472 TATATTATGAATAATATCACAGG + Intergenic
961277176 3:125737005-125737027 AAGATTACAAATAATATCGAAGG + Intergenic
961278514 3:125746071-125746093 TATATTATGAATAATATCACAGG + Intergenic
961875888 3:130023585-130023607 TATATTATGAATAATATCACAGG - Intergenic
961877248 3:130032722-130032744 AAGATTACAAATAATATCGATGG - Intergenic
961877284 3:130033078-130033100 GAGATTACGAATGATATCACAGG - Intergenic
965399957 3:168202888-168202910 GATATTATGAATGATATCCTAGG + Intergenic
965400054 3:168203636-168203658 TATATTATGAATAATATCACAGG + Intergenic
966236586 3:177708271-177708293 TTAGTTATGAATGATATTGAAGG + Intergenic
966298541 3:178452341-178452363 TAGATTTTGAATGGAATTGAAGG + Intronic
967588494 3:191243921-191243943 AAGATTATGAAGGAAATCAAGGG + Intronic
968988250 4:3891330-3891352 TATATTATGAATAATATCACAGG - Intergenic
968989489 4:3899756-3899778 AAGATTACAAATAATATCGAAGG - Intergenic
969019245 4:4128631-4128653 TAGATTATGAATAATATCACAGG - Intergenic
969023880 4:4158507-4158529 TATATTATGAATAATATCACAGG - Intergenic
969729945 4:8948563-8948585 TATATTATGAATAATATCACAGG + Intergenic
969734813 4:8980354-8980376 TATATTATGAATAATATCACAGG + Intergenic
969786101 4:9458189-9458211 TATATTATGAATAATATCACAGG + Intergenic
969787600 4:9471414-9471436 GAGATTACGAATGATATCACAGG + Intergenic
969787633 4:9471770-9471792 AAGATTACAAATAATATCGAAGG + Intergenic
969789545 4:9482673-9482695 TATATTATGAATAATATCACAGG + Intergenic
969794022 4:9511843-9511865 TATATTATGAATAATATCACAGG + Intergenic
970493220 4:16597775-16597797 TATATTATGAATGAAAACGATGG - Intronic
971552222 4:27972067-27972089 TAGATTATGTATTATTTAGAGGG + Intergenic
972657388 4:41077627-41077649 TAGATTATCAATCATATGTAAGG + Intronic
973719330 4:53707316-53707338 TGGATCATGAAAGATATCTATGG + Intronic
980718109 4:136654712-136654734 TATATTATGAAAAATATCTAGGG - Intergenic
986035537 5:3933518-3933540 TAAATTATGAATTATGTCCAAGG - Intergenic
986298469 5:6459155-6459177 TACATTATGAAAGAGATCAAAGG - Intronic
986354731 5:6912557-6912579 GAGACAATGAATGATATAGATGG + Intergenic
990386210 5:55265791-55265813 TAGATTTTGAAGCATATCCAAGG - Intronic
994391137 5:99194575-99194597 GATATTATGAATAATATCAATGG + Intergenic
994391149 5:99194714-99194736 GATATTATGAATAATATCAAGGG + Intergenic
994396653 5:99230890-99230912 AACATTATGAATAATATCGCTGG - Intergenic
994681854 5:102897806-102897828 TAGAATAGGAATGATATCTTTGG + Intronic
996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG + Intronic
997686464 5:135791522-135791544 GATATTATGAATGATATCACTGG - Intergenic
997688137 5:135803704-135803726 GATATTATGAATCATATCAAAGG + Intergenic
1009056050 6:58336694-58336716 TAGATTCCGAATGACATAGATGG + Intergenic
1013713651 6:112931697-112931719 TGAATTATAAATGATGTCGAAGG + Intergenic
1014864359 6:126509450-126509472 TTGATGATGAATGTTATCAAAGG - Intergenic
1016353013 6:143188198-143188220 TAGAGTCTAAATCATATCGATGG - Intronic
1020310984 7:6868679-6868701 TATATTATGAATAATATCACCGG - Intergenic
1028909556 7:96192736-96192758 TAGATTTTGAAGTATATCAAGGG - Intronic
1029077685 7:97948994-97949016 TATATTATGAATAATATCACAGG - Intergenic
1029079513 7:97961026-97961048 AAGATTACAAATAATATCGAAGG - Intergenic
1029079765 7:97963358-97963380 TATATTACGAATAATATCAAAGG - Intergenic
1030487545 7:110189311-110189333 TAGATTAGGAATGATAGTGATGG + Intergenic
1031508781 7:122622804-122622826 TAGATTTTGAATGATGTCAAGGG - Intronic
1032672466 7:134097919-134097941 TAGATGATCAGTGATATCCAAGG + Intergenic
1036548583 8:9796563-9796585 TATATTATGAATGATATCACAGG + Intergenic
1036548628 8:9797208-9797230 GATATTATGAATGATATCACAGG + Intergenic
1036548634 8:9797280-9797302 GATATTATGAATGATATCACAGG + Intergenic
1036548683 8:9797895-9797917 GATATTATGAATAATATCAAGGG - Intergenic
1036819675 8:11930598-11930620 TATATTATGAATAATATCACAGG - Intergenic
1036907281 8:12717832-12717854 GAGATTACGAATGATATCACAGG - Intergenic
1036907382 8:12718815-12718837 TATATTACGAATAATATCAAAGG - Intergenic
1038298560 8:26320358-26320380 GAGAATATTAATGATATCGGAGG - Intronic
1038640966 8:29326381-29326403 GATATTATGAATGATATCACGGG + Intergenic
1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG + Intronic
1041553849 8:59130827-59130849 TAGATTCTGAATTATATTCAAGG - Intergenic
1041992810 8:64014510-64014532 TAGAGTATGAATGCTATCAAAGG + Intergenic
1042009591 8:64226847-64226869 TAGATTATGAATGTTATGTCAGG + Intergenic
1045922100 8:107543361-107543383 TAAATTATGAATGATATTTTTGG - Intergenic
1045924056 8:107566557-107566579 GATATTATGAACGATATCGCGGG - Intergenic
1046181978 8:110661460-110661482 TAGATTAAGAAATATACCGAAGG - Intergenic
1046444135 8:114293767-114293789 TAGTTTATAAATGATATAGTTGG - Intergenic
1048148387 8:131868170-131868192 TTGATTATGAATGAGATTGGAGG - Intergenic
1048901853 8:139045979-139046001 AAGATAATGAATGATATTGAAGG + Intergenic
1050285575 9:4098372-4098394 TAGAAGATGAATGATATAGAAGG + Intronic
1052734510 9:32326782-32326804 TCGATTATGAATGTTCTCAATGG + Intergenic
1054354556 9:64048881-64048903 TATATTATGAACAATATCGCAGG - Intergenic
1056866444 9:90231061-90231083 TATATTATGAATAATATCACAGG + Intergenic
1188416864 X:29945795-29945817 AGGATTATGATTGATATAGAAGG + Intronic
1189732732 X:44038569-44038591 TAGATGATGCCTGATATCTACGG + Intergenic
1190775892 X:53552033-53552055 GTGATCATGAATGATACCGAGGG - Intronic
1193740504 X:85210976-85210998 TAGATTGGTAATGATATCAAGGG - Intergenic
1197303037 X:124804441-124804463 TAGATTTTGAATGACTTCAAAGG - Intronic
1200817339 Y:7547332-7547354 TGCATTATGAATGATTTCAAAGG - Intergenic