ID: 1075886399

View in Genome Browser
Species Human (GRCh38)
Location 10:125903157-125903179
Sequence CTTTACTTCTTGATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075886391_1075886399 20 Left 1075886391 10:125903114-125903136 CCAAACATGGTCTCCAGATGGAG 0: 5
1: 0
2: 0
3: 10
4: 147
Right 1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG No data
1075886395_1075886399 -9 Left 1075886395 10:125903143-125903165 CCTCAGAACCTGGGCTTTACTTC 0: 5
1: 0
2: 0
3: 27
4: 450
Right 1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG No data
1075886392_1075886399 7 Left 1075886392 10:125903127-125903149 CCAGATGGAGTCTGTTCCTCAGA 0: 4
1: 1
2: 2
3: 13
4: 137
Right 1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075886399 Original CRISPR CTTTACTTCTTGATGGGAGA AGG Intronic
No off target data available for this crispr