ID: 1075894694

View in Genome Browser
Species Human (GRCh38)
Location 10:125984637-125984659
Sequence CAGAGTCATCAGCATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075894691_1075894694 11 Left 1075894691 10:125984603-125984625 CCAGGGAAAGGGTCTGGGTTGGA 0: 1
1: 1
2: 0
3: 19
4: 319
Right 1075894694 10:125984637-125984659 CAGAGTCATCAGCATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075894694 Original CRISPR CAGAGTCATCAGCATGAGGC TGG Intronic
No off target data available for this crispr