ID: 1075897132

View in Genome Browser
Species Human (GRCh38)
Location 10:126006442-126006464
Sequence TCACTACCACACATGGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075897132_1075897139 21 Left 1075897132 10:126006442-126006464 CCACGTGCCATGTGTGGTAGTGA No data
Right 1075897139 10:126006486-126006508 GTTTATGATGAATTCTGGGCAGG No data
1075897132_1075897137 16 Left 1075897132 10:126006442-126006464 CCACGTGCCATGTGTGGTAGTGA No data
Right 1075897137 10:126006481-126006503 GATTGGTTTATGATGAATTCTGG No data
1075897132_1075897134 -1 Left 1075897132 10:126006442-126006464 CCACGTGCCATGTGTGGTAGTGA No data
Right 1075897134 10:126006464-126006486 ACAGCCACACACTCCTTGATTGG No data
1075897132_1075897138 17 Left 1075897132 10:126006442-126006464 CCACGTGCCATGTGTGGTAGTGA No data
Right 1075897138 10:126006482-126006504 ATTGGTTTATGATGAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075897132 Original CRISPR TCACTACCACACATGGCACG TGG (reversed) Intronic
No off target data available for this crispr