ID: 1075897398

View in Genome Browser
Species Human (GRCh38)
Location 10:126008943-126008965
Sequence TGGGGTTGCAGGGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 600}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075897392_1075897398 -9 Left 1075897392 10:126008929-126008951 CCACAGTGGTCTTTTGGGGTTGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG 0: 1
1: 0
2: 5
3: 79
4: 600
1075897388_1075897398 1 Left 1075897388 10:126008919-126008941 CCATGCAAAGCCACAGTGGTCTT 0: 1
1: 0
2: 4
3: 51
4: 957
Right 1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG 0: 1
1: 0
2: 5
3: 79
4: 600
1075897386_1075897398 9 Left 1075897386 10:126008911-126008933 CCTGCAGGCCATGCAAAGCCACA 0: 1
1: 1
2: 4
3: 43
4: 278
Right 1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG 0: 1
1: 0
2: 5
3: 79
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075897398 Original CRISPR TGGGGTTGCAGGGGGGCTGC TGG Intronic
900143802 1:1149564-1149586 TGGGTTTGCTGGAGGGCTGAGGG + Intergenic
900336080 1:2164450-2164472 TGTGGTATCAGTGGGGCTGCAGG + Intronic
900652304 1:3735690-3735712 AGGGGTTGGAGGGAGGCTGCTGG + Exonic
901221549 1:7586578-7586600 TGGGGCAGGAGGGAGGCTGCAGG - Intronic
901520355 1:9779097-9779119 TGGAGCAGCAGGGGGTCTGCCGG + Intronic
901628421 1:10636291-10636313 TGGGGGTCCTGGGAGGCTGCAGG + Intergenic
901631245 1:10649225-10649247 TGGGGCTCCAGGGCGGGTGCGGG + Intronic
901737650 1:11322504-11322526 TGGGGACGAAGTGGGGCTGCGGG - Intergenic
902234630 1:15049462-15049484 TGGGGTGGAGGGGGTGCTGCTGG - Intronic
903287389 1:22285617-22285639 TGGGGCTGCACTGGGGCTCCTGG + Intergenic
903370334 1:22831185-22831207 TGGGGATGAAGGGCGGCTGCAGG + Intronic
903551694 1:24161595-24161617 GGGGCATGCAGGGGGGCAGCTGG + Exonic
903750030 1:25616216-25616238 CCGGGCTGCAGGGGTGCTGCTGG - Intergenic
903833888 1:26190428-26190450 TGGGGATGCTGTGGGGATGCTGG - Intergenic
903891486 1:26573182-26573204 GGGGGTTGGGGGAGGGCTGCAGG - Intronic
904311366 1:29631809-29631831 GGGGCTTGCAGAGGGGCGGCCGG + Intergenic
904482960 1:30805525-30805547 GGGGGTGGGAAGGGGGCTGCCGG + Intergenic
904842052 1:33379287-33379309 TGGGGGGGCAGGGGGGCGGTGGG - Intronic
904872465 1:33627431-33627453 TGAGGCTGCAGGGGGGCAGCAGG - Intronic
905283804 1:36866203-36866225 TGGTGTAGCATGGGAGCTGCTGG + Intronic
905351213 1:37347797-37347819 GGAAGTTGGAGGGGGGCTGCTGG - Intergenic
906203769 1:43976002-43976024 TGGGGTTGAAGGGGGTTTGAGGG + Intronic
906231656 1:44169678-44169700 TTGGGTTTCGGGGGGGATGCAGG + Intergenic
906476276 1:46171566-46171588 TGGGGTTGGAGCTGGGCTTCCGG + Intronic
907697080 1:56742050-56742072 GGGGGTGGCAGTGGGGCTGGGGG + Intronic
908458516 1:64327261-64327283 TGAGGTTGCCGGGTGTCTGCGGG - Intergenic
908501017 1:64744625-64744647 TGGGGCGGCCCGGGGGCTGCGGG - Intergenic
910678099 1:89835124-89835146 TGGGGGTGGAGGGGTGCTCCTGG - Intronic
912551890 1:110490079-110490101 TGGGGTGGCAGGAGGGGTTCTGG + Intergenic
912659266 1:111513925-111513947 TGCGGTTGCATGGGAGCTGGTGG + Intronic
913278703 1:117164361-117164383 TGGGGTTGCGGGGGCGATACGGG + Intronic
913453170 1:119006695-119006717 TGGGGAGGCAGGGAGGCTGTCGG + Intergenic
914492254 1:148159910-148159932 TGCGGTTGCAGGGAGGCTTGCGG - Intergenic
914902162 1:151716663-151716685 GGGGGTGGGAGGGGGGCTGAGGG - Exonic
915288892 1:154869801-154869823 AGGGGCTGCTGGGGGGCTGCTGG + Exonic
915591620 1:156874245-156874267 GGGGGATGGAGGTGGGCTGCTGG - Intronic
916053434 1:161051672-161051694 TGGGCTTGGCCGGGGGCTGCTGG + Exonic
916787887 1:168099273-168099295 GGGGGTTGCTAGGGGACTGCAGG + Intronic
919892155 1:201983162-201983184 TGAGGGTGCAGGGCGGCTGGGGG - Intronic
920309934 1:205043070-205043092 TGGGGTGGGAGGGGGGCAGAAGG + Intergenic
920380316 1:205531302-205531324 TGGGGCTGCAGGGAGGAGGCTGG - Intronic
920416162 1:205800522-205800544 TGGGATGGCCGGGGGGCTGGGGG + Intronic
922208441 1:223468987-223469009 TGGGGAGGAAGAGGGGCTGCTGG - Intergenic
922290518 1:224205629-224205651 TGGGGTTGGGGGGGGGGGGCTGG - Intergenic
922606378 1:226892167-226892189 TGGGGTTGGGGAGGGGCGGCAGG + Intronic
922648578 1:227317964-227317986 GGGGGTGGAAGGCGGGCTGCGGG + Exonic
922776403 1:228216040-228216062 TGGGGCTGCAGGGGTCCTGCTGG + Intronic
922796010 1:228340249-228340271 GGGGGGTGCAGGGAGGCTGTGGG - Intronic
922802951 1:228372369-228372391 TGGAGATGCAGGGGGCATGCTGG + Exonic
924110247 1:240691844-240691866 AGGGGCTTCACGGGGGCTGCAGG - Intergenic
924631272 1:245743074-245743096 TGGGCAGGCAGGGGGGCAGCCGG - Intergenic
1063015792 10:2076077-2076099 TGGGGGTGCAGGGTGGGGGCTGG - Intergenic
1064047213 10:12027984-12028006 TGGATTTGGAGGGGGGCTGAGGG - Intronic
1065435842 10:25703118-25703140 TGAGGTTACAGTGAGGCTGCCGG - Intergenic
1066462625 10:35624960-35624982 TGGAGTTGCAGAGAGGCTGGGGG + Intergenic
1067065513 10:43102001-43102023 GGGTGTGGCAGGGGGGGTGCTGG + Intronic
1067361838 10:45589244-45589266 TGGGGTTGCAGTCAAGCTGCTGG + Intronic
1067513063 10:46911460-46911482 TGGGGTTGCAGCGGGACAGTTGG + Intronic
1067649190 10:48140382-48140404 TGGGGTTGCAGCGGGACAGTTGG - Intergenic
1069104777 10:64370057-64370079 TGGGGTTGAAGCTGGGCAGCAGG - Intergenic
1069505392 10:68992915-68992937 TAGGGTTGGGGAGGGGCTGCAGG + Intronic
1069539033 10:69279483-69279505 TGGGTTTGCATGGGGTTTGCAGG + Intronic
1069674015 10:70234118-70234140 TAGGGTGGCAGGGGGGATGGAGG - Intergenic
1070536524 10:77382239-77382261 AGGGGCTGCAGGGGGACTGGTGG - Intronic
1070768261 10:79068567-79068589 GGGGCCTGCAGGGGGGCTGGGGG + Intergenic
1070916878 10:80160780-80160802 TGGAGCTGCAGGGAGGCTGCTGG - Intronic
1070956346 10:80465950-80465972 TGGGGTTGCAGGCGGGGTGAAGG + Intronic
1071296217 10:84222031-84222053 CGGGGCTGCAGGGGTGCAGCTGG + Exonic
1071559207 10:86632298-86632320 TGGGGCAGCTGGAGGGCTGCAGG + Intergenic
1072227901 10:93387215-93387237 TGGGGCAGCTGGGGGGCTGGCGG + Intronic
1073047571 10:100649646-100649668 TGGGGTGGGATGGGGGCTGGGGG + Intergenic
1073064606 10:100750630-100750652 TGGCGGGGCAGGGGGGCTGCAGG - Intronic
1073433032 10:103499214-103499236 TGAGGCTGCTGGGGGGCTGAAGG + Intronic
1074356741 10:112792424-112792446 TCGGGTCCCAGGTGGGCTGCTGG - Intronic
1074532337 10:114305949-114305971 TGCAGATGCAGGGGGGGTGCAGG + Intronic
1074824195 10:117202738-117202760 TGGGGGAGCAGTGGGTCTGCAGG + Intronic
1075088577 10:119430253-119430275 TGGGGCTGCTGTGGGGCTCCTGG + Intronic
1075225649 10:120626363-120626385 TGGGGTGGCAGGGGTGCTAATGG + Intergenic
1075713369 10:124542554-124542576 TGGGGATGCAGGAGAGCTGCAGG - Intronic
1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG + Intronic
1076315105 10:129534285-129534307 TGAGGCAGCAGGGAGGCTGCAGG + Intronic
1076830591 10:132992398-132992420 GTGGGATGCAGAGGGGCTGCTGG + Intergenic
1076856191 10:133116552-133116574 TGGGTGTGCTGGGGGGCAGCTGG - Intronic
1076887867 10:133270840-133270862 TGGCCTGGCAGGGTGGCTGCAGG - Intronic
1077093075 11:788301-788323 CGGGGTTGCATCGGGACTGCTGG + Exonic
1077182954 11:1224566-1224588 TGGGGCTGGGGAGGGGCTGCTGG + Intronic
1077326678 11:1967005-1967027 AGGAGGTGCTGGGGGGCTGCAGG + Intronic
1077356466 11:2121137-2121159 TGGGGTGGAAGGGGTGGTGCTGG - Intergenic
1078060550 11:8040095-8040117 TGGGAGGGCAGGGGGGCTGGAGG - Intronic
1078180057 11:9003961-9003983 TGAGGCTGCCGGGGGGCTGTGGG - Exonic
1078455065 11:11468589-11468611 TGGGGCTGCAGGGAGGTTGCTGG + Intronic
1079434136 11:20428908-20428930 TGGGGTTGCACAGTGGATGCTGG - Intronic
1079458700 11:20660736-20660758 TGGGAGTCCAGGGGGGATGCTGG + Intergenic
1079678922 11:23267639-23267661 TGGAGTTGGAGGGAGGCTGAGGG - Intergenic
1081761290 11:45577929-45577951 TGGGGTATCAGGGAAGCTGCAGG - Intergenic
1082870779 11:57942605-57942627 TGGGGCTGCAGGGAGGGAGCAGG - Intergenic
1083163005 11:60867284-60867306 TGAGGTTGCAGATGGGCTGTGGG - Intergenic
1083462760 11:62825440-62825462 TGGTGTTGGAGTGGGTCTGCAGG + Exonic
1083655610 11:64227740-64227762 TGGGCTGGCAGGAGGCCTGCAGG + Intronic
1083671152 11:64300527-64300549 TGGGGTTGGGTGGGGGCTGCGGG - Exonic
1083722417 11:64609924-64609946 TGGGGCTGCAGTGGGGCAGGCGG - Intronic
1084199565 11:67546562-67546584 TGGGGCTTAAGTGGGGCTGCAGG - Intergenic
1084438171 11:69156063-69156085 AGGGGCTCCAGGGTGGCTGCGGG + Intergenic
1084488236 11:69463579-69463601 TGGGGTGGGATGGGGGCTGCAGG - Intergenic
1084562390 11:69912130-69912152 TGGGTTTGGAGGGAGGGTGCTGG + Intergenic
1084958586 11:72704244-72704266 TGGGGCTGCTGCTGGGCTGCAGG + Exonic
1084970918 11:72771673-72771695 TGGAGGTCCAGGGAGGCTGCTGG - Intronic
1085270662 11:75267910-75267932 TGGGGCTGCAGTGGGGATCCGGG - Intronic
1085622195 11:78045940-78045962 TGAGGACGCAGGGAGGCTGCCGG + Intronic
1085977240 11:81672776-81672798 TGGGGTTGCAGTGGGGAGGTGGG + Intergenic
1086411756 11:86550992-86551014 GGGGGTTGCCGGTGGGCTGGTGG + Intronic
1086817808 11:91394834-91394856 GTGGCTAGCAGGGGGGCTGCGGG - Intergenic
1087394459 11:97579807-97579829 TGGGGTTTCTGGGGGGATGGTGG - Intergenic
1089602331 11:119623651-119623673 TGGGGTGGCAGGTGGGCAGCTGG + Intronic
1089711385 11:120317292-120317314 TTGAGATGCAGTGGGGCTGCTGG - Exonic
1089762727 11:120740247-120740269 TGGGGTTGTAGTTAGGCTGCTGG + Intronic
1090134794 11:124186046-124186068 TGGGGTTGGGTGTGGGCTGCAGG - Exonic
1090272905 11:125400362-125400384 TGGGTGTGCAGGTGGGCTGAGGG - Intronic
1090663048 11:128895377-128895399 TGGGGTTGGGGGGGGGGTGGGGG - Intronic
1090665811 11:128914335-128914357 TGGGGGTGCAGCGGGGCAGCGGG - Intronic
1091030756 11:132185795-132185817 TGGAGTAGGAAGGGGGCTGCAGG + Intronic
1091216632 11:133906342-133906364 ACGGGCTGCAGGAGGGCTGCTGG + Intergenic
1202809659 11_KI270721v1_random:22185-22207 AGGAGGTGCTGGGGGGCTGCAGG + Intergenic
1091759604 12:3077869-3077891 CGCGGGTGCCGGGGGGCTGCAGG - Intronic
1092529382 12:9331886-9331908 TGTGGCTGCAGGGAGGCTGGGGG + Intergenic
1096243585 12:49972455-49972477 TGGGGTTGCAGAGGGGCGGGTGG - Intronic
1096788414 12:54030899-54030921 GGGGCTTGCAGGGGGCCGGCAGG - Intronic
1096809833 12:54162196-54162218 TGGGGGTGCAGTGGGACTGGAGG - Intergenic
1097618137 12:61907900-61907922 TGGGCTTGCATGAGGCCTGCAGG + Intronic
1100220509 12:92499983-92500005 GGGGATTGCAGGGGGGCTATAGG + Intergenic
1101824925 12:108212699-108212721 TGGGTGAGCTGGGGGGCTGCTGG + Intronic
1101918854 12:108916545-108916567 TGGGGAGGCAGAAGGGCTGCTGG - Intronic
1101999501 12:109548014-109548036 TGGGGATGGAGTGGGGGTGCGGG + Intergenic
1102031797 12:109744011-109744033 CGGGGTTGCAGGGAGACTCCCGG + Intronic
1102635289 12:114318344-114318366 TGGGCTTACAGGTGAGCTGCTGG - Intergenic
1103503421 12:121423265-121423287 TGGGGTGGCATTGGGCCTGCAGG + Intronic
1103601521 12:122057523-122057545 CCGGGTTGGAGGGGGGGTGCGGG + Intronic
1103693614 12:122796193-122796215 TGGGGTTGTCGGGGGGCGGTGGG - Intronic
1103913267 12:124363420-124363442 TGGGGGTTCAAGGGTGCTGCGGG + Intronic
1104053292 12:125210623-125210645 TGGGGTGGCAGGGGAGGTGGAGG + Intronic
1104218455 12:126758132-126758154 AGGGGGTGGAGGGGAGCTGCTGG + Intergenic
1104926758 12:132317808-132317830 TGGGGCTGCACAGGGGCTGCTGG + Intronic
1104940241 12:132391887-132391909 TGGGGTGGCAGAGGGTCTCCAGG - Intergenic
1105069677 12:133226975-133226997 GGGGGTTGCCTGAGGGCTGCAGG + Exonic
1105292442 13:19061530-19061552 TGGGGGTGGAGGGAGGATGCAGG - Intergenic
1105356362 13:19663478-19663500 TGGAGCAGCAGGGAGGCTGCTGG + Intronic
1106200922 13:27536669-27536691 GCGAGTGGCAGGGGGGCTGCAGG + Intergenic
1106435901 13:29722560-29722582 GTGGGTTGCAGGAGGGCTGTGGG - Intergenic
1107199372 13:37695419-37695441 TGGAGTAGGAGGGGGGCTGTAGG - Intronic
1107288588 13:38824973-38824995 TGGGGGTGGAGGGGGGCGGCGGG + Intronic
1107925575 13:45258466-45258488 TGGGGTGGCAAGAGGTCTGCAGG - Intronic
1109379531 13:61541628-61541650 TGGGGTTGAAGAAGGGCTTCTGG - Intergenic
1109416949 13:62052346-62052368 TTTGGGTGGAGGGGGGCTGCTGG + Intergenic
1111996070 13:95167476-95167498 TGGGGTAGCAGGGAGGGTCCTGG - Intronic
1112356107 13:98675994-98676016 TGGGGCTGCAGCGAGACTGCAGG - Intergenic
1112545646 13:100366659-100366681 TGGGGGTGCAGGGGAGTTGAGGG - Intronic
1112778360 13:102870149-102870171 TGGGGCTGCATTGGGCCTGCAGG + Intronic
1113709117 13:112452530-112452552 TGGTGTTTCTGGGGGGCTGCTGG - Intergenic
1113749663 13:112768394-112768416 TGGGGATCCAGGGTGCCTGCCGG + Intronic
1113955985 13:114099922-114099944 GGGGGCTGCAGGGGGGCTGTGGG - Intronic
1114453852 14:22843192-22843214 TGGGGAAGCAGGGAGGCTGAGGG + Intronic
1114548555 14:23520386-23520408 TGGGCCTCCAGGGGGGCAGCAGG + Intergenic
1115761244 14:36580790-36580812 TGGGGCTGCAGGGAGGCGGACGG + Exonic
1116187001 14:41609795-41609817 TGGGGCTGCTGGGGGGCGGGGGG + Intronic
1117507050 14:56414481-56414503 TGGGGAAGCAGTGGGTCTGCTGG + Intergenic
1118329215 14:64802717-64802739 TGGTGTTGCTGCGGGGCTGGCGG - Intronic
1118363741 14:65076867-65076889 TGGGATTGCAGAGTGTCTGCTGG - Intronic
1119732814 14:76961857-76961879 TGGGGCCGCAGCGGGGCTTCCGG - Intergenic
1122246601 14:100407561-100407583 TGCGTTTCCAGGGGAGCTGCTGG + Intronic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1122811935 14:104293429-104293451 TGGAGGGGCCGGGGGGCTGCAGG + Intergenic
1123019873 14:105392642-105392664 TGGGGCTGCAGGTGGACTACTGG + Exonic
1123124754 14:105938255-105938277 TGTGTCTGCTGGGGGGCTGCAGG - Intergenic
1124471666 15:29992543-29992565 TGGGGTTGCAGTGGGAGTGTTGG - Intergenic
1125956042 15:43792061-43792083 TGGGGGTGGAGGGGTGCGGCTGG - Intronic
1126848583 15:52784484-52784506 TGGGGCTTAAGGGGGGCTGATGG - Intronic
1127849126 15:62897788-62897810 TGGGGCTGCAGGTGGTCTGCAGG - Intergenic
1127997686 15:64163087-64163109 TGGGGTTGCTCGCGGGCTCCGGG + Exonic
1128250198 15:66158569-66158591 TGGGGTTGCATGGAGGATCCAGG + Intronic
1128458193 15:67844886-67844908 TGGGGGTGCAGGGGTAGTGCTGG + Intergenic
1128498427 15:68211019-68211041 TGGCGATGCTGGGGGGATGCTGG + Intronic
1129685300 15:77682724-77682746 GGGGGTGGCTGGGGGACTGCAGG - Intronic
1129920186 15:79312941-79312963 TGGGGTTGCAGTGGAGATGTGGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130313000 15:82771319-82771341 TGGGGTTGAAGTGGGATTGCTGG - Intronic
1131054685 15:89368378-89368400 TGGGGTTGCAGAGGGGTCGCTGG + Intergenic
1132104231 15:99051299-99051321 AGGGGGAGCAGGGGGGCTGAGGG - Intergenic
1132113859 15:99121342-99121364 TGGGGTGTCTGGGTGGCTGCAGG + Intronic
1132311648 15:100861955-100861977 ATGGGTTGCTGGGGGGCAGCTGG + Intergenic
1132607006 16:797770-797792 TGGGGTTGTGGGGGGCCTGGGGG + Intronic
1133296296 16:4754103-4754125 TGGGGTGCCTGGGGGGCTGGGGG + Intronic
1133344285 16:5059843-5059865 TGGGGTTGGAGGTAGGATGCTGG + Intronic
1133359956 16:5166371-5166393 TGGCATAGCAGGGGGCCTGCAGG - Intergenic
1134036065 16:11032325-11032347 TGGGGCTGCTGGGGGGCAGTTGG + Intronic
1134204541 16:12226535-12226557 TGGGTTTCCAGGGGAGCTGAAGG + Intronic
1134853583 16:17501583-17501605 TGAAGTTGCAGGCGGCCTGCTGG - Intergenic
1136157283 16:28391706-28391728 TGGGATTGCAGGGTGGCAGAGGG - Intronic
1136205803 16:28723575-28723597 TGGGATTGCAGGGTGGCAGAGGG + Intronic
1136222408 16:28836744-28836766 GGGGGTGGAAGGGGAGCTGCTGG - Exonic
1136272194 16:29154928-29154950 AGGGGCCGCAGGGGGGCAGCTGG + Intergenic
1136610851 16:31364039-31364061 TTGGGGTGGAGGGCGGCTGCAGG - Intronic
1137274244 16:46923106-46923128 GGGGGTAGAAGGGTGGCTGCTGG - Intronic
1138227530 16:55310319-55310341 TGGGGTTGGGTGGGTGCTGCTGG + Intergenic
1138389098 16:56657591-56657613 TGGGGTTGCACTGGGACTCCAGG + Intronic
1138390906 16:56669418-56669440 TGGGGTTGCACTGGGACTCCAGG + Intronic
1138528273 16:57621054-57621076 TGGAGTTGCGGGTGGGGTGCTGG + Intronic
1138537630 16:57668252-57668274 TGGGGCTGCAGGGTGGGGGCAGG + Exonic
1139436726 16:66940820-66940842 TGGAATTGCTGGGGGGCTCCAGG + Intronic
1139957505 16:70700166-70700188 TGGGGTTGCTTTGGGGCTGGGGG - Intronic
1140228342 16:73096672-73096694 TGGGATTACAGGGGGATTGCAGG + Intergenic
1140295116 16:73702297-73702319 AGGGGCTGCCTGGGGGCTGCAGG + Intergenic
1140388095 16:74560453-74560475 TGCGGGGGCAGGGGGGCGGCGGG - Intronic
1141242223 16:82274646-82274668 TGTGGTTCCAGGGGGGATGGAGG + Intergenic
1141604006 16:85142772-85142794 CGGGGTTGTAGGGGGGCAGTGGG + Intergenic
1141638639 16:85328877-85328899 AGGGGTGGCAGGGGTGCAGCTGG - Intergenic
1141797800 16:86286636-86286658 AGGGGCCGCAGGGGCGCTGCGGG + Intergenic
1141927306 16:87177974-87177996 GGGGGTTGCAGGGAGGAGGCTGG + Intronic
1142075771 16:88116832-88116854 AGGGGCCGCAGGGGGGCAGCTGG + Intronic
1142199185 16:88753125-88753147 TGGGGGGGCAGGGGTGCTCCGGG - Intronic
1142249931 16:88986561-88986583 TGGGGCTGTAGGGGGGCAGGCGG - Intergenic
1142359215 16:89618957-89618979 CGGGGGGGCAGGGGGGCTGCAGG - Intronic
1142359327 16:89619201-89619223 AGGGAGGGCAGGGGGGCTGCAGG - Intronic
1142611090 17:1109476-1109498 TGGGGTTGCGGGGCCGCGGCTGG + Intronic
1142851068 17:2704989-2705011 CTGGGCTGCAGGGGGGCTGCAGG + Intronic
1143109044 17:4543355-4543377 TGGGGTGACAGGGGCGCTCCAGG + Intronic
1143338006 17:6187998-6188020 TGGGAGAGAAGGGGGGCTGCAGG - Intergenic
1143471608 17:7179134-7179156 TGGGGGTGCAGGGGTGCGGAGGG - Intronic
1143487242 17:7261706-7261728 CTGGGTTGCCGGGGAGCTGCAGG - Intronic
1143625930 17:8110100-8110122 TGGGGTGGCAGAGCGGCAGCTGG + Exonic
1143764585 17:9129194-9129216 TGGGTTTAGAGGGGGTCTGCTGG + Intronic
1144042566 17:11425864-11425886 GGGTGTTGCACTGGGGCTGCAGG - Intronic
1144686000 17:17226853-17226875 TGTGGCTGCAGCGGGGCAGCGGG - Intronic
1145053290 17:19680942-19680964 TGGGATTACAGGCGTGCTGCAGG - Intronic
1145235099 17:21202568-21202590 TGGGCTTGCAGGGGGGCCGGAGG - Intronic
1145280647 17:21464626-21464648 TCAGGTAGCATGGGGGCTGCTGG - Intergenic
1145291412 17:21549508-21549530 TGTGGTTGCATGGGGGTTGGGGG + Intronic
1145761972 17:27430319-27430341 TGGGGCTGCAGGGCAGCTGGCGG - Intergenic
1146126791 17:30237134-30237156 GAGGGGTGCAGGGGGGATGCCGG + Intergenic
1146126826 17:30237220-30237242 GGGGGTTGCAGGGGAGATCCTGG + Intergenic
1146126842 17:30237265-30237287 AAGGGCTGCAGGGGGGATGCTGG + Intergenic
1146126849 17:30237285-30237307 TGGGGGTGCAGGGGAGATGCTGG + Intergenic
1146126860 17:30237308-30237330 GGGGGCTGCAGGGGGGATGCTGG + Intergenic
1146126899 17:30237417-30237439 GGAGGTTGCAGGGGGGATGCTGG + Intergenic
1146373824 17:32281320-32281342 TGGGGGTGCAGTGGGGGTGCTGG - Intronic
1146940673 17:36842394-36842416 TGGGGCTGGAAGGGGGCTGTTGG - Intergenic
1147238088 17:39072282-39072304 TGGGGAGGCAGGGGGGCTTCTGG - Intronic
1147317797 17:39629112-39629134 TGGGGGTGGGGGAGGGCTGCAGG + Intronic
1147546583 17:41406599-41406621 TGGGGTTGCACACGGGTTGCAGG + Intergenic
1148048667 17:44758918-44758940 TGGGGGGGCCGGGGGGCGGCGGG + Intergenic
1148215212 17:45830406-45830428 TGGGGTGGCAGGGCTGGTGCAGG + Exonic
1148339189 17:46863254-46863276 TGGGACTGCAGGGAGGCTGAGGG + Intronic
1148407013 17:47424207-47424229 AGGCTGTGCAGGGGGGCTGCGGG + Intronic
1148857069 17:50584609-50584631 GGGGGTGACAGGGGGGCGGCGGG + Intronic
1149639771 17:58195143-58195165 TGGGAAAGCAGGGGGGCAGCTGG - Exonic
1149655317 17:58306746-58306768 TGGAGTTGGAAGGGGGCTGGTGG + Intronic
1150183483 17:63153634-63153656 TTGGGTTACAGGGCTGCTGCAGG + Intronic
1150640937 17:66948975-66948997 TGAGGTTGCAGGGGGAATGAAGG - Intergenic
1151679978 17:75617958-75617980 TGGGCTGGCAGGGAGGCGGCAGG + Intergenic
1151830448 17:76546198-76546220 TGGAGCTGCAGGGCGGCTGAGGG + Intronic
1151842275 17:76626998-76627020 AGGGGCTGGAGGGGGGCTGGAGG + Intronic
1151942199 17:77299919-77299941 TGGGGTAGGAGGAGGGCTGGGGG - Intronic
1151975553 17:77481922-77481944 TGGGGAGGCAGCGTGGCTGCAGG + Intronic
1152057278 17:78039843-78039865 TGGGGCTGCCTGGGGGCAGCGGG - Intronic
1152178667 17:78803923-78803945 GGGGGCTGAAGGGGGGTTGCAGG + Exonic
1152245655 17:79183368-79183390 TGGGGCGGCAGGGGGGCGCCCGG + Intronic
1152280086 17:79380056-79380078 AGGGGCTGCAGTGGGGCTGTGGG - Intronic
1152323210 17:79620738-79620760 TGGGGTTCCAGGAGGGCATCAGG - Intergenic
1152330738 17:79671143-79671165 GGGGGCTGCAGGGGGGTTGGTGG + Intergenic
1152389425 17:79993876-79993898 GGTGGTTGCATGGGGGCTGGGGG - Intronic
1152572293 17:81126133-81126155 TGGGGTTGGCGCGGGGCTGCAGG + Intronic
1152589278 17:81203460-81203482 TGGGGAGGCCGCGGGGCTGCGGG - Intronic
1152636101 17:81431092-81431114 TGGGGGTGGAGGGGCTCTGCTGG + Intronic
1152920101 17:83062259-83062281 TCGGGTTTCTGGGTGGCTGCTGG - Intergenic
1152934409 17:83127751-83127773 TGGGATTGTAGGGGGGGTGTGGG + Intergenic
1153057682 18:963427-963449 TGGGGCTGGAGTGGGGCTGGTGG + Intergenic
1153596587 18:6731658-6731680 TTGGGTTGCAGGGGGCCAGGGGG - Intronic
1153670602 18:7408406-7408428 AGGGGTTGGAGGCGGGCTGCAGG - Intergenic
1153697999 18:7663884-7663906 TGGGGCTGGAGGGGGGCAGAGGG - Intronic
1154344642 18:13531874-13531896 TGAGGATGCAGGGTGGCTGGTGG + Intronic
1155225322 18:23724917-23724939 TGGTGGTGCAGGAAGGCTGCAGG - Intronic
1156513538 18:37661197-37661219 TGGGCATGGAGGGGGGTTGCAGG + Intergenic
1156538746 18:37888986-37889008 TGGAGAAGCAAGGGGGCTGCAGG + Intergenic
1157102350 18:44742434-44742456 TGGGGTGGCAGAGAGGATGCTGG + Intronic
1157283586 18:46362060-46362082 TGGGGTGGCAGGGGGGCCTTTGG - Intronic
1157616214 18:48989155-48989177 TGGGGCTGCCCGGGGGCTGTGGG + Intergenic
1158319649 18:56248884-56248906 TGGGGGTGGAGGGGGGCAGGGGG + Intergenic
1158941033 18:62406070-62406092 GGAGGTTTCAGGGGGGCTGAAGG - Intergenic
1158995311 18:62912501-62912523 TGGGGTTGCTGGGGGGTGGGAGG - Intronic
1160497513 18:79383950-79383972 TGGGCCTGCCAGGGGGCTGCAGG - Intergenic
1160675630 19:389867-389889 TGGGGCTGCAGAGGGACTGGGGG - Intergenic
1160858575 19:1228126-1228148 CTGGGTGGCAGGGGGGCTGTGGG + Exonic
1160913915 19:1487798-1487820 TGGGGGTGTAGCGGGGCTGGGGG + Exonic
1160972710 19:1776471-1776493 TGGGCTTGCAGGGGGGCAGCGGG + Exonic
1161209411 19:3058462-3058484 TGGGGCTGCAAGGCGGCTCCCGG + Intronic
1161211013 19:3065796-3065818 TGGGGTGGCAGGGGTGCTAGCGG - Intergenic
1161321863 19:3645166-3645188 GGGGGTTGCAGGGAGGTGGCAGG - Intronic
1161358249 19:3831678-3831700 TGGGGTTGTAGGAGGGCGGGGGG + Exonic
1161473470 19:4472643-4472665 TGGGGTTGTCCGGGGCCTGCCGG + Intronic
1161587889 19:5115268-5115290 TGGGGGTGCTGGGGGGATGTGGG + Intronic
1161828096 19:6583016-6583038 TAAGGTTGGAGAGGGGCTGCAGG + Intergenic
1161851864 19:6741283-6741305 TAAGGTTGGAGAGGGGCTGCAGG + Intronic
1162477285 19:10908182-10908204 GTGAGTGGCAGGGGGGCTGCCGG - Intronic
1162949435 19:14061908-14061930 TGGGGGGTCAGGGGGGCTGGTGG - Intergenic
1163581861 19:18144152-18144174 TGGGGTTCCTTGGGGGCTGGGGG - Intronic
1163634338 19:18431367-18431389 TGGGGTTGTGGGGGGACGGCTGG - Exonic
1163673699 19:18644723-18644745 TGGGGCTGCTGGGGGGCAGTGGG + Intronic
1163686949 19:18717219-18717241 TGGGGCTGAGAGGGGGCTGCTGG + Intronic
1163708901 19:18833549-18833571 TGGGGTGGGAGAGGGGCTGGGGG + Intronic
1165092111 19:33392943-33392965 TGGGGTCTCAGGCGGGCTGGGGG + Intronic
1165093115 19:33396816-33396838 TGGAGCTCCAGGGTGGCTGCAGG + Intronic
1165331586 19:35143383-35143405 GGGGGTTGCAGGGGGGCTCCGGG + Intronic
1165469740 19:35996365-35996387 TGTGGTGGCAGGGGGGCTGGGGG - Intergenic
1165739588 19:38197474-38197496 TGGGGTTGCCGTGGGGGGGCAGG - Intronic
1165811426 19:38614216-38614238 TGGGGGTGTAGGGGTGCTGTTGG - Intronic
1165832739 19:38737286-38737308 TGGGGGGGCTGGGGGGCTGCAGG - Exonic
1165856368 19:38881068-38881090 TGGGGATGCGGGGAGGCTGGGGG + Intronic
1165888879 19:39098897-39098919 TGGGGTTGGAGGGAGGGTCCCGG + Intronic
1165969789 19:39617797-39617819 TTGGGTTGCAGGGGAGATGGAGG + Intergenic
1166337535 19:42117311-42117333 TGAGGGGGCAGGGGTGCTGCTGG + Exonic
1166500527 19:43337737-43337759 TGGTGGTGCAGGGGACCTGCAGG + Intergenic
1166509596 19:43395962-43395984 TGGTGGTGCAGGGGACCTGCAGG - Intergenic
1166568613 19:43779926-43779948 TGGGGTTGGTGGGGGGAGGCAGG + Intronic
1167161261 19:47768757-47768779 TGGAGCTGCAGCGTGGCTGCTGG + Intergenic
1167645857 19:50704411-50704433 TGGGGCTGCAGGGGATGTGCTGG - Intronic
1167741360 19:51326611-51326633 TGGGGTGGGGGAGGGGCTGCAGG - Intronic
1167960041 19:53098127-53098149 TGGGGTGGTTGTGGGGCTGCAGG - Intronic
1168293036 19:55366210-55366232 AGGGGGTGCAGCGGGGGTGCAGG + Intronic
925057268 2:864890-864912 TGTGGTTGCATTGGGCCTGCTGG - Intergenic
925342702 2:3148123-3148145 TGGGGCAGCGGGGGAGCTGCTGG - Intergenic
925385416 2:3458468-3458490 TGGGGTTTCTGGGGAACTGCTGG + Intronic
925420659 2:3708134-3708156 TGGGGGTGCAGAGGAGCTGGAGG + Intronic
925578537 2:5385355-5385377 TGGCGTAGCAGGTGGCCTGCTGG - Intergenic
925688610 2:6496774-6496796 TGGGGTTGAGTGGGGACTGCAGG + Intergenic
927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG + Intronic
927414612 2:22865832-22865854 TGGGGGTGCAGGGATGGTGCAGG + Intergenic
927475648 2:23412447-23412469 TGGATATGCAGGTGGGCTGCAGG + Intronic
927576545 2:24206382-24206404 TGGAGATGCAGGGGGCCGGCGGG + Intronic
927709164 2:25314481-25314503 TGGGGTGGGAGGGAGGATGCGGG - Intronic
928065571 2:28161293-28161315 TAGGGTTCCTGGGGGGCTCCAGG + Intronic
928065770 2:28163190-28163212 GGGGGAAGCAGGGTGGCTGCCGG - Intronic
928098033 2:28417424-28417446 TGGGGTGGCAGGGGGGCTGGGGG + Intergenic
928361123 2:30663092-30663114 TGGGGTGGGAGAGGGGCTGGAGG + Intergenic
929033431 2:37670366-37670388 TGAGGTTGTAGGGGGGCTCTAGG - Intronic
929095815 2:38262501-38262523 TGGGCATGCAGGTGGTCTGCGGG - Intergenic
931550951 2:63445625-63445647 AGGGGTTGGAGGGAGGCTTCTGG + Intronic
932056554 2:68449083-68449105 TGGTGGTGCAGGGGAGCAGCCGG - Intergenic
934663420 2:96154913-96154935 TGGGGTTGCAGGGTGAATGGGGG - Intergenic
935918078 2:107979463-107979485 TGTGGTGGCTGGGGGGCTGGGGG + Intergenic
936091131 2:109502020-109502042 GGAGGTTGCAGGAGGTCTGCAGG + Intronic
936255090 2:110904395-110904417 AGGGGTTGCTGTGGAGCTGCTGG + Intronic
936257936 2:110933656-110933678 TGGGGACCCACGGGGGCTGCAGG - Intronic
937041347 2:118823104-118823126 GGGGGTAGGAGGGGTGCTGCAGG + Intergenic
937223696 2:120356397-120356419 TGGGGTAGGAGGAGAGCTGCAGG - Intergenic
937395345 2:121530143-121530165 AGGGGAGGCAGGGTGGCTGCCGG + Intronic
937419295 2:121741125-121741147 TGGGGTGGCATGGGGGGTGGAGG - Intronic
938187207 2:129242529-129242551 TGGGGCTGCAGTGGGGCTCAGGG + Intergenic
938552020 2:132391227-132391249 TGGGTTGGCAGGGTGGCTGTGGG + Intergenic
940104600 2:150084088-150084110 TGGGGTTGTAAGGTGGCAGCAGG + Intergenic
940845618 2:158638632-158638654 TGGGGGTGCAGGTGGGGTGAGGG + Intronic
941029478 2:160494031-160494053 TGGGGGTGGAGGGGGAATGCGGG + Intergenic
942858556 2:180582254-180582276 TGGGGTTGGAGGGAGGATGATGG + Intergenic
943917723 2:193658555-193658577 TGGGGTGGCAGGGCGGGTGGGGG + Intergenic
946191329 2:218009614-218009636 TGGGGTGGCTGGGGGACGGCAGG - Intergenic
947459371 2:230289867-230289889 TGGGGTTGCAGGTGGGGGACTGG - Intronic
947532908 2:230924088-230924110 TGGGGTTGCTGGAGGACAGCAGG - Intronic
948132515 2:235611035-235611057 TGGGGTTGCAGGCAGGCGGCTGG - Intronic
948163352 2:235843166-235843188 TGGGGGTACAGGGAGCCTGCAGG - Intronic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948766860 2:240226919-240226941 TGGGCTGGCAGGGGTGGTGCAGG - Intergenic
948790824 2:240375990-240376012 TGGTGCAGCAGGAGGGCTGCTGG + Intergenic
948793463 2:240390834-240390856 TGGGACAGCAGGGGAGCTGCTGG - Intergenic
948864063 2:240766561-240766583 TGGGGGCACAGGTGGGCTGCTGG - Intronic
948874311 2:240819078-240819100 TGGGGTTGGGGGGGCCCTGCCGG - Intronic
1168750238 20:276948-276970 TGGGGCTGCAGTGGGCCTGGAGG + Intronic
1168957213 20:1842718-1842740 TGGGGTGGCATGGGGAATGCAGG - Intergenic
1169021193 20:2332367-2332389 TGGGGCTGCAGGGTGTCTGCTGG + Intronic
1169028147 20:2386860-2386882 TGGGATTGGATGAGGGCTGCTGG - Intronic
1169405099 20:5315967-5315989 TGGGGCGGGAAGGGGGCTGCTGG - Intergenic
1170047179 20:12097922-12097944 TGGGGTTCCAGGAGGGTGGCAGG - Intergenic
1170516744 20:17137944-17137966 TGGGTTTGGAGGGGAGCTGTGGG - Intergenic
1170893750 20:20396392-20396414 TGGGGCTGCAGGGAGCCAGCGGG - Intronic
1171154417 20:22859202-22859224 TGGGGCTCCCTGGGGGCTGCTGG + Intergenic
1171392914 20:24812461-24812483 TGGGGTGGCATGGGAGCTGCTGG - Intergenic
1171438043 20:25139111-25139133 GGGTGATGCAGGGGAGCTGCTGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172384860 20:34526933-34526955 TTGGGGTGGAGGGGAGCTGCAGG - Intronic
1172529419 20:35619561-35619583 TGGGGCTGCAGGCGGGCGGAGGG - Exonic
1172799866 20:37568108-37568130 TGGGGTTGGGGGGCGTCTGCTGG + Intergenic
1172800688 20:37574235-37574257 TGCGGTGGCAGAGGGGCTGAAGG + Intergenic
1172934470 20:38609852-38609874 TGGGGTTGCAGCCGGGCTCAGGG - Intronic
1173184554 20:40830671-40830693 TGGGGGTGGAGCAGGGCTGCTGG + Intergenic
1173461035 20:43243546-43243568 TGGGGTGGCAGTGGGGATGGTGG - Intergenic
1174205482 20:48835161-48835183 AGGTGTTGCAGGTGGGCTGTGGG + Intergenic
1174863758 20:54116055-54116077 GGGGGTGGCGGGGGGGCGGCGGG - Intergenic
1174938018 20:54893537-54893559 TGGGGTTCCAGGGGGTGTGTGGG + Intergenic
1175217342 20:57398539-57398561 TGGGGGGGCAGGGGGGCGGCGGG - Intronic
1175313092 20:58025308-58025330 GGGCGTTGGAGGGGGGCTGGTGG + Intergenic
1175400904 20:58699334-58699356 TTGGGTGGCAGGGGGTCGGCGGG + Intronic
1176096151 20:63345446-63345468 TGGGGACACTGGGGGGCTGCCGG + Exonic
1176103710 20:63375991-63376013 TGGGGTTGCAGGGTTGGTGGGGG - Intronic
1176144796 20:63560753-63560775 AGGGGCTGCAGGTGGGCTGGGGG + Intronic
1176258409 20:64166066-64166088 CGGGGTGGCAGGGAGGCTGGGGG - Intronic
1176360060 21:5987687-5987709 TGGCTTTGCCGAGGGGCTGCTGG + Intergenic
1176703761 21:10093228-10093250 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
1177320383 21:19512977-19512999 TTGGGCTGAAGGGGGACTGCTGG - Intergenic
1179763458 21:43550863-43550885 TGGCTTTGCCGAGGGGCTGCTGG - Intronic
1179970773 21:44836001-44836023 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970786 21:44836026-44836048 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970843 21:44836143-44836165 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970910 21:44836280-44836302 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970931 21:44836321-44836343 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970963 21:44836383-44836405 TGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1180020523 21:45122587-45122609 TGGGGTTGAAGATGAGCTGCTGG + Intronic
1180066221 21:45413857-45413879 TGGGATTGGAGGGGTGCTGAGGG + Intronic
1180172771 21:46068341-46068363 GGGGCTTGCAGGGGGGCGGATGG - Intergenic
1180722037 22:17916661-17916683 TGGGGTTGTGGGGGGGCAGACGG - Intronic
1181028555 22:20139138-20139160 TGGGGGTGCAGAGCGGATGCAGG - Intronic
1181399126 22:22640606-22640628 TAAGGTTGCAGGGAGGCTGGGGG - Intergenic
1181439618 22:22929011-22929033 AGGGGGTGCAGGGGCCCTGCTGG + Intergenic
1181650295 22:24255453-24255475 TAAGGTTGCAGGGAGGCTGAGGG + Intergenic
1181696246 22:24594186-24594208 TGGGGCTGCAGGGGCCCAGCAGG - Intronic
1182061997 22:27405053-27405075 TGGGGCTGCAGAGGGGTTCCTGG + Intergenic
1182297568 22:29318704-29318726 AGGGATTGGAGGGGGGCAGCAGG - Intronic
1182421497 22:30250752-30250774 CGGGGTTGGGGGGGGGATGCGGG + Intergenic
1182786425 22:32911537-32911559 TGGGATGGGAGGGGGGCAGCAGG + Intronic
1183002666 22:34874619-34874641 TGGGGGTGCAGGGGGGCTCTAGG + Intergenic
1183063665 22:35349834-35349856 TGGGGCTGCATGGGGGCTGGGGG + Intergenic
1183080180 22:35451175-35451197 TGAGGTTGCAAGTGGGCTGTAGG - Intergenic
1183251662 22:36734445-36734467 TGGGGCTGCAGCAGGGCTGATGG + Intergenic
1183315667 22:37135688-37135710 TGGGGGTGGTGGGGGGCTGTAGG - Intronic
1183603115 22:38851394-38851416 CTGGGCTGCAGGGGGGCAGCAGG + Intergenic
1183742654 22:39677448-39677470 TGGGGGTGCAGCAGGGCTGCAGG + Intronic
1184094598 22:42309642-42309664 GGGAGTTGCAGGGGCGTTGCTGG - Intronic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1184260459 22:43312482-43312504 TGGGGTTGGGGGGAGGCTGGTGG + Intronic
1184455473 22:44607418-44607440 TGAGGATGCATGGGGGTTGCAGG + Intergenic
1184641816 22:45876917-45876939 TGGGGATGGATGTGGGCTGCAGG - Intergenic
1184795326 22:46728814-46728836 TGGGGCAGCAGGGTGGGTGCAGG + Intronic
1185233166 22:49694813-49694835 TGGGGTGGAAGGAGGGGTGCAGG + Intergenic
1185281787 22:49972733-49972755 TGGGGTTGCCAGGGGGCCGTGGG - Intergenic
1185408556 22:50671388-50671410 TGGGGTGGCAGCGGGGCAGTGGG + Intergenic
949520824 3:4852535-4852557 TCGGGTTGCAGAGGGGCTCACGG - Intronic
949908389 3:8878762-8878784 TGGGGGTGCAGGTGAGCTGCTGG - Exonic
950264801 3:11565614-11565636 TGGGGTTCCCGGGGTGCTGTAGG + Intronic
950556010 3:13696485-13696507 TGGGGCTGCAGAGGGGATCCAGG - Intergenic
950630427 3:14278529-14278551 TGTGGTTGCAGTGGGGTGGCGGG + Intergenic
951485666 3:23206574-23206596 TGGGGTTGAAGGGGTGCTGGTGG + Intronic
951590588 3:24260379-24260401 TGGGGTTGCAGGGTGGATTTTGG + Intronic
951703853 3:25524449-25524471 GGTGGTTCCAGTGGGGCTGCTGG - Intronic
952389907 3:32871128-32871150 TGGGGTGGAAGGGGGTCTTCCGG + Intronic
952559945 3:34580032-34580054 TGGAGGTGCAGGGGAGTTGCTGG + Intergenic
953351734 3:42221331-42221353 TGGGGATGCTGGTGGGCTGGGGG - Intronic
953391661 3:42537363-42537385 TGGGGTGGCAAGGGGGATTCAGG - Exonic
954422266 3:50424956-50424978 TTGGCTTACAGGGGTGCTGCTGG - Intronic
954422471 3:50425952-50425974 GGGGGTTGCTGGGGAGCAGCTGG - Intronic
955322072 3:57981670-57981692 TGGGGGTGCAGGGTGGCTGCGGG + Intergenic
956420447 3:69081435-69081457 TGGGGTGGCGGGGGGGCGGTGGG - Intergenic
957215760 3:77317740-77317762 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215789 3:77317809-77317831 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215798 3:77317831-77317853 GGGGGCTGCTAGGGGGCTGCTGG + Intronic
957215803 3:77317842-77317864 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215814 3:77317865-77317887 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957401904 3:79726287-79726309 TGGGGTTGGAGGAGGGCTTGAGG - Intronic
959769745 3:110078795-110078817 TGGGGTTGAAGGAGGGCTTGAGG - Intergenic
960166750 3:114411170-114411192 TGGGGGTGCAGAGGAGGTGCAGG + Intronic
961006919 3:123411645-123411667 TGGGGTTGGATTGGGGGTGCTGG - Intronic
961780053 3:129315978-129316000 AGGGGGTGCAGGGGGGCTGGGGG + Exonic
961816787 3:129555259-129555281 GGGGGCTGGAGGGGGGCAGCTGG - Exonic
962093505 3:132269961-132269983 TGGGGTTGGGGGTGGGGTGCAGG + Intronic
964129426 3:153270404-153270426 CTGGGTAGGAGGGGGGCTGCTGG - Intergenic
964630257 3:158802239-158802261 TGGGGTCGCAGAGGGCCGGCAGG - Exonic
964634673 3:158845986-158846008 TGGGGTTGAGGCGGGGCAGCAGG - Intergenic
964722811 3:159784037-159784059 TGGGATGGAAGGGGGACTGCAGG - Intronic
966696271 3:182793470-182793492 TGGGGTTGCGGGGGTGCTTTGGG + Intergenic
966813076 3:183865648-183865670 CGGGGTTGCAGGGGGGCAGATGG - Intronic
966925799 3:184643857-184643879 TGGGGGTGCTGGGGGACTGAAGG - Intronic
967879218 3:194287407-194287429 AGAGGTTGCAGGGAGGCTGCAGG - Intergenic
968045914 3:195623893-195623915 TGGGGTTGGAGGGTGGATGGTGG + Intergenic
968107094 3:196009119-196009141 AGGGGATGCAGGGGGGATGCGGG - Intergenic
968308740 3:197666194-197666216 TGGGGTTGGAGGGTGGATGGTGG - Intergenic
968958408 4:3730549-3730571 TGGGGGTGCAGGGTGGGTGCCGG + Intergenic
968958422 4:3730579-3730601 TGGGGGTGCAGGGTGGGTGCCGG + Intergenic
969277855 4:6149002-6149024 TAGGTTTGCAGGGGGGTGGCGGG + Intronic
969402904 4:6968745-6968767 TGGGGTTGGAGGCAGGCTACCGG - Intronic
969479162 4:7438105-7438127 TGGGGCAGCACTGGGGCTGCTGG - Intronic
969529955 4:7725147-7725169 AGGGCCTGCAGGGGGGCTGTGGG - Exonic
970598829 4:17624745-17624767 TGGGGGTGGGGAGGGGCTGCAGG + Exonic
971234164 4:24826419-24826441 TGGGGATGCAGGGGTGCTACAGG + Intronic
972398200 4:38674974-38674996 CGGGGCTGCAGGTGAGCTGCAGG - Intronic
973697726 4:53507257-53507279 TGGGCTTCCAGGGGGACTTCAGG - Intronic
974099796 4:57403913-57403935 TGGGGTAGCAGGGGAGGTGGTGG + Intergenic
975900119 4:79141398-79141420 TGGGGCAGCAGGGGTGATGCTGG + Intergenic
977757360 4:100689117-100689139 TGGGGATGCATGTGGGATGCTGG + Intronic
980375977 4:131949580-131949602 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
980847628 4:138343118-138343140 TGGAGTTGCAGGAGAGCTGAAGG + Intergenic
984616463 4:181904145-181904167 TGGGGATGCTCTGGGGCTGCAGG - Intergenic
985440350 4:189979372-189979394 CTGGGGTGCAGGGGGGCTGCCGG + Intergenic
985521825 5:377422-377444 TGGGCTTGCAGGGAGGAGGCGGG + Intronic
985680340 5:1252784-1252806 TGGGGTGGCAGGGGTGATGGGGG - Intergenic
985700371 5:1368224-1368246 TGGGGATGCAGAGGCGCTGTTGG - Intergenic
985747379 5:1654949-1654971 TGGAGTTGCAGGGTGGATGGTGG - Intergenic
985824734 5:2183826-2183848 TGGGCCTGCGGGGAGGCTGCTGG + Intergenic
985970883 5:3377533-3377555 TGGAGATGCAGGGAGGCTGAAGG + Intergenic
985970902 5:3377630-3377652 TGGAGATGCAGGGAGGCTGAAGG + Intergenic
986197305 5:5549762-5549784 AGGGGCTGCAGGGGCTCTGCTGG + Intergenic
986315397 5:6583331-6583353 TGGGGTTCCAGGGCTGGTGCTGG - Intergenic
986333308 5:6734166-6734188 TGCGGTTGCAGGGAGGCCGAAGG + Intronic
986510021 5:8494773-8494795 TAGGGCTGCAGGAGGGCTGAAGG + Intergenic
989156818 5:38352210-38352232 TGTGGCTGCTGGGGAGCTGCAGG - Exonic
991557373 5:67910812-67910834 TGGGGGTGCAGGGGGCATGGAGG - Intergenic
992098978 5:73388267-73388289 TGGGGGTGCTGGGAAGCTGCTGG - Intergenic
992207577 5:74445825-74445847 GGGTGTCGCAGGGGGGCTTCAGG + Intergenic
992533850 5:77678489-77678511 AGGGGTTGCAGAGGGGATGGAGG + Intergenic
995449007 5:112279930-112279952 GGGGGTGGTAGGTGGGCTGCAGG - Intronic
995650458 5:114362625-114362647 TGGGGCTGGCGGCGGGCTGCAGG - Exonic
996119021 5:119650204-119650226 TGGGGTAGCAGGGAGGCAGTGGG - Intergenic
997626545 5:135335172-135335194 TGGGATGCCACGGGGGCTGCAGG + Intronic
997700179 5:135892045-135892067 TGGAGCTGCAGGAGGGCTGCAGG - Intergenic
997740869 5:136252616-136252638 TGGGGTTGGAGTGGGGGTGGAGG + Intronic
998099870 5:139423891-139423913 TGGGGCTGCAGGGGGATTACTGG - Intronic
998385733 5:141756216-141756238 TAGGGTTGGAGTGGGGCTGAGGG + Intergenic
998417320 5:141955397-141955419 TGAGGTGGAAGGGGGCCTGCAGG + Exonic
998511671 5:142718984-142719006 TGGGGTGGGAGGGGGGCCGGGGG + Intergenic
998642922 5:144032397-144032419 TGGGGCTCCATGGGTGCTGCCGG + Intergenic
999254890 5:150204753-150204775 TGGGGTAGAGGAGGGGCTGCTGG + Intronic
999290111 5:150419274-150419296 AGGGGTTGCTGGGGGGCTGTGGG + Intergenic
999698537 5:154207355-154207377 TCTGGTTGCAGGGAGGTTGCAGG + Intronic
1000597687 5:163234718-163234740 GGGGGGTGGAGGGGGGCTGCGGG - Intergenic
1001234001 5:170014151-170014173 TGGGGTTGGGGAGAGGCTGCTGG + Intronic
1001276387 5:170354596-170354618 TGGGGTGGCAGGTGGTTTGCAGG + Intronic
1001724238 5:173883494-173883516 AGAGGTTGCAGGGAAGCTGCAGG - Intergenic
1001959374 5:175871230-175871252 TCTGGTTGCAGGGAGGCGGCAGG + Intronic
1002161065 5:177314397-177314419 TGGGGCTGCAGAGGGGCTGGAGG + Intergenic
1002424106 5:179165698-179165720 TGGGGCTGCATGGTAGCTGCAGG + Intronic
1002453021 5:179330454-179330476 GGCAGTTGCAGGGAGGCTGCTGG - Intronic
1002791671 6:441732-441754 TTGGGTTGCAGGTGGGATGCAGG + Intergenic
1002994603 6:2270968-2270990 TGGGGTGGCAGTGGGGGTGGAGG + Intergenic
1003276818 6:4660775-4660797 TGGGGTGGGAGGGGGGCTGCTGG - Intergenic
1003689306 6:8337053-8337075 TGGGGTTCCTGTGGGGCAGCTGG - Intergenic
1004113972 6:12749287-12749309 TGGGGCTGCAGGCGGGAGGCGGG + Intronic
1006155409 6:32010639-32010661 GGGGATTGCAGGGGGGAGGCTGG - Intergenic
1006161715 6:32043373-32043395 GGGGATTGCAGGGGGGAGGCTGG - Intronic
1006164081 6:32054261-32054283 TGGGGTGGCAGGGAGCCTGGAGG - Intronic
1006164705 6:32057459-32057481 TGGGGTGGCAGGGAGCCTGGAGG - Intronic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1006390008 6:33752629-33752651 TGGGGTTGCAGGGTGGCTAGTGG + Intergenic
1006502463 6:34467207-34467229 TGGGGTATCAGGGAAGCTGCTGG - Intronic
1006643089 6:35498302-35498324 TGGGGGCGCTGAGGGGCTGCTGG + Exonic
1006830252 6:36964061-36964083 TTGGGGTGAAGGGGGGCTGCTGG - Intronic
1006899503 6:37490831-37490853 TGGGCTCTCAGGGAGGCTGCAGG - Intronic
1007781092 6:44255201-44255223 TGTGGTGGCTGGGGAGCTGCGGG + Exonic
1008625988 6:53316765-53316787 TGAGGAAGCATGGGGGCTGCGGG + Intronic
1009996663 6:70902895-70902917 AGGGGTGGCAGGGGGGCTGGTGG + Intronic
1011599897 6:89050305-89050327 TGGGGTTCCCGGAGGGCTGAGGG - Intergenic
1012102019 6:95101958-95101980 TGGGGTTGCAAAGGGGTTGTGGG - Intergenic
1013305682 6:108844937-108844959 TGGGGTGGCAGGGGTGGTACGGG + Intergenic
1015742134 6:136468053-136468075 TGGGGCTGTAGGGGTGGTGCTGG - Intronic
1015938244 6:138424169-138424191 TGGGGCTGCAGGGAGGCGGCAGG + Exonic
1016753686 6:147660395-147660417 TAGGGAAGCAGGGTGGCTGCAGG - Intronic
1017025390 6:150176782-150176804 TGGGTTTGCAGAGGGCCTGAAGG + Intronic
1017881512 6:158565712-158565734 GGGGGTGGGAGGGGAGCTGCAGG + Intronic
1018375004 6:163202082-163202104 TGGGGCAGCAGGAGGGCAGCAGG + Intronic
1018396257 6:163380122-163380144 TCGGGGTGCAGGGAGGATGCAGG - Intergenic
1018581967 6:165315549-165315571 TGGGGCTGCAGGGGGGATCAGGG - Intergenic
1018734632 6:166678372-166678394 TGGGCTTGCAGGGCGGCTTGTGG - Intronic
1018905476 6:168073193-168073215 TGGTGTTGCAGGGGGGTGACTGG - Intronic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019537860 7:1538352-1538374 TGGGGTTCCTGAGGGGCGGCAGG - Intronic
1019705016 7:2493469-2493491 TGGGAGAGCAGGGGGGCTGCAGG + Intergenic
1019729749 7:2623356-2623378 GGGGCTGGCAGGGGGGCAGCAGG + Intergenic
1019873236 7:3786861-3786883 TGGGGGTGTGGGGGAGCTGCAGG - Intronic
1020000413 7:4752576-4752598 TGAGGTGGCAGGCGGGCTCCTGG - Intronic
1020090008 7:5333546-5333568 TGGGGTGGGAGGAGGGCTGCTGG - Intronic
1021100541 7:16583708-16583730 TGGAGTGGAAGGGGAGCTGCTGG + Intergenic
1022536371 7:31101164-31101186 TGGGGCTGCTGTGGGGCTGCTGG + Intronic
1023722639 7:43112494-43112516 TGGGGGTGCGCGGAGGCTGCAGG + Intergenic
1023806674 7:43877551-43877573 TGTGGAGGCAGGGAGGCTGCCGG - Exonic
1024934287 7:54697721-54697743 TGCGGCTGCGGAGGGGCTGCTGG - Intergenic
1026466392 7:70658493-70658515 GGGAGTTGTAGAGGGGCTGCTGG - Intronic
1026742886 7:72990168-72990190 TGGGGTGGAAAGGGGGATGCTGG - Intergenic
1026848856 7:73712456-73712478 TGGGGGGGCAGGGAGGCTTCTGG - Intronic
1026991133 7:74586470-74586492 TGGGCACGCAGGGGGGCTGGCGG + Intronic
1027100849 7:75374910-75374932 TGGGGTGGAAAGGGGGATGCTGG + Intergenic
1027152548 7:75742762-75742784 TGGCGTGGCAGGGAGGCAGCTGG + Intergenic
1028479252 7:91286665-91286687 AGGGGCAGCAGAGGGGCTGCAGG + Intergenic
1029109036 7:98202775-98202797 TGAAGTTGCTGGGGGGCTCCTGG - Intronic
1029358463 7:100070487-100070509 GGGGATGGCAGGGGGTCTGCTGG + Exonic
1029468325 7:100740086-100740108 TGAGGTAGCAGTGGGGCTGTCGG + Intronic
1029614062 7:101645289-101645311 TGGGGGTGCAGAGGGGTTGGAGG + Intergenic
1029665532 7:101992778-101992800 GGGGGTTGGAGGGGGGCGGCGGG - Intronic
1029943458 7:104506241-104506263 TGGGGTTGGGTGGGGGCAGCGGG - Intronic
1031975700 7:128092196-128092218 TGGGGTGGCATCGGGGCTGCGGG + Exonic
1032079399 7:128851136-128851158 GGGGTTGGCAGGGAGGCTGCTGG + Intronic
1032197416 7:129797438-129797460 TGGAGTTGCAGTGGGTCTGCAGG - Intergenic
1034271531 7:149805561-149805583 TGGGCATACAGGGGGGCTGCAGG - Intergenic
1034442850 7:151095810-151095832 TGGGGTGGCAGGGGGGCAGGGGG - Intronic
1035313440 7:157983937-157983959 AGGGATTCCAGGGAGGCTGCAGG - Intronic
1035374777 7:158400877-158400899 GGGGGTGGGACGGGGGCTGCTGG - Intronic
1035569629 8:663401-663423 GGGGGTGTCAGGCGGGCTGCTGG - Intronic
1035677749 8:1467257-1467279 TGAGGGTGCAGTGGGGCTGGGGG - Intergenic
1036727341 8:11231604-11231626 GGGAGTTGCAGGAGAGCTGCAGG + Intergenic
1037671642 8:21020214-21020236 TGGGGTAGCAGAGGGCCTGCAGG + Intergenic
1037821961 8:22139372-22139394 AGGGGTGGGATGGGGGCTGCTGG + Intronic
1037859055 8:22391886-22391908 TCAGGTTGCAGGGGCGATGCAGG + Intronic
1038954600 8:32453806-32453828 ATGGGTTGCAAGGGGGCAGCTGG - Intronic
1039517782 8:38147811-38147833 TGGGCTTGCAGGGGTGATGTGGG - Intronic
1040319791 8:46286743-46286765 ACGGGTGGCAGCGGGGCTGCAGG - Intergenic
1040323097 8:46328323-46328345 TTGGGTGGCAGTGGGGCTGCAGG - Intergenic
1041076510 8:54174821-54174843 TGCGGGCGCAGCGGGGCTGCGGG - Intergenic
1045549158 8:103154668-103154690 TGGGGTGACAGGTGGGCTGTGGG - Intronic
1045872157 8:106939354-106939376 TGGGGGTGGAGGAGGGCTGGTGG + Intergenic
1047409965 8:124616265-124616287 TGGATTTGCAGGGAAGCTGCTGG + Intronic
1047490059 8:125366911-125366933 TGGGGTAGGAGGTAGGCTGCTGG - Exonic
1047885872 8:129249468-129249490 TGGAGGTGCAGGGGAGTTGCAGG - Intergenic
1048053925 8:130846214-130846236 TGGGGTTGGCTGGGGTCTGCTGG + Intronic
1048588397 8:135797460-135797482 TTGGGGTACAGGGTGGCTGCTGG + Intergenic
1048697281 8:137041769-137041791 TGGCATTGCAGTGGGGCAGCAGG + Intergenic
1049235627 8:141510865-141510887 GTGTGTAGCAGGGGGGCTGCTGG + Intergenic
1049437834 8:142595816-142595838 GGGGCTTCCATGGGGGCTGCTGG + Intergenic
1049480860 8:142821818-142821840 TGGGGTTGCAGGCAGGAAGCAGG + Intergenic
1049538384 8:143193718-143193740 TGGGGCTGCCGGGCGGCTGGTGG - Intergenic
1049573371 8:143379712-143379734 TGAGGTGCCAGGGAGGCTGCTGG + Intronic
1049601411 8:143509510-143509532 TGGGGTTGGGGGTGGGCTGGTGG - Intronic
1049614907 8:143571883-143571905 TGGGGGTGGAGGTGGGGTGCAGG - Intronic
1049659614 8:143813932-143813954 TGGGGCTGCAGACGGCCTGCAGG - Intronic
1049746431 8:144265151-144265173 GGGGGTTGCAGGGGGAGTGCAGG + Intronic
1049749371 8:144276124-144276146 TGGGGTTGCCCTGGGGGTGCTGG - Intronic
1049879264 8:145051448-145051470 TAGGGTTTCAGGGGGGCAACGGG - Intergenic
1051262835 9:15281604-15281626 TGCTGTTGCAGGGGGGATGTTGG - Intronic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1051744523 9:20282569-20282591 TGGGGGTGCGGGGTTGCTGCTGG - Intergenic
1052040501 9:23733473-23733495 TGGGGCTACAACGGGGCTGCTGG + Intronic
1052986528 9:34491951-34491973 AGGGGGAGGAGGGGGGCTGCAGG - Intronic
1053094962 9:35318387-35318409 TGGGGTGGCGGGGCGGCAGCGGG - Intronic
1053593062 9:39533448-39533470 GGGGGTCGCAGGGGGTCTGTGGG - Intergenic
1053799205 9:41753863-41753885 TGGGCTGGCATGGGGGGTGCTGG - Intergenic
1053850799 9:42288156-42288178 GGGGGTCGCAGGGGGTCTGTGGG - Intergenic
1054146007 9:61561136-61561158 TGGGCTGGCATGGGGGGTGCTGG + Intergenic
1054573244 9:66831829-66831851 GGGGGTCGCAGGGGGTCTGTGGG + Intergenic
1056710784 9:88990945-88990967 TGGGCTTGCAGGTGGGCGCCTGG - Exonic
1057491439 9:95522994-95523016 TGTGTTTGGAGGGGGGCTCCGGG + Intergenic
1058095492 9:100855589-100855611 TGGGGCTGCACGAAGGCTGCTGG + Intergenic
1060815367 9:126632417-126632439 AGGGGCTGCCGAGGGGCTGCTGG + Intronic
1060871759 9:127048221-127048243 TGGTGTTGCAGGAGTGCTGTGGG - Intronic
1060937219 9:127522571-127522593 TGGGGCTGGAGGGGGGCCTCTGG - Intronic
1061123116 9:128656476-128656498 CGGGGTCGCAGCGCGGCTGCCGG - Intronic
1061132161 9:128714264-128714286 GGGAGCTGCAGGGGGGCAGCAGG - Exonic
1061133569 9:128721294-128721316 AGGGGTTGCTGGGGCGCTGGCGG + Exonic
1061491473 9:130947290-130947312 TGGGGCTGCAGGGGAGGTGCTGG - Intergenic
1061540997 9:131277719-131277741 TGGGGCTTCGGGGGGGCGGCCGG + Intergenic
1061679458 9:132235830-132235852 TGAGGTTGGAGGGGGGCCGCAGG + Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062035064 9:134379316-134379338 TGGGGATGAAGGAGGGCTGGGGG + Intronic
1062039244 9:134396538-134396560 TAGGGTTGCAGGGACGTTGCAGG + Intronic
1062243293 9:135551033-135551055 TGTGGGTGCAGGGGTGATGCTGG + Intergenic
1062264221 9:135679539-135679561 TGGGGGTGCAGAAGGACTGCTGG - Intergenic
1062272039 9:135714183-135714205 AGGGGTTGCAGGGGTGTGGCGGG + Intronic
1202788798 9_KI270719v1_random:63323-63345 GGGGGTGGCAGGGGGGTTGGGGG + Intergenic
1203786325 EBV:129911-129933 TGGAGATGAAGGGAGGCTGCCGG - Intergenic
1203787830 EBV:137520-137542 TGGGGTGGCTGGCGGGCTGGGGG - Intergenic
1186514746 X:10158632-10158654 TGGGGGCGCAGCCGGGCTGCAGG - Intronic
1186977381 X:14922810-14922832 GGGTGTTGCAGAGGGGCAGCAGG + Intergenic
1187238286 X:17488437-17488459 TGGGGTTACAGGGGTGATGTAGG + Intronic
1187562770 X:20418370-20418392 TTGGGTTGGAGTGGGGGTGCTGG - Intergenic
1187563839 X:20428625-20428647 TGGGGTAGTAGGGGGGCAGGGGG + Intergenic
1189332420 X:40152112-40152134 TGGGGTTGCAGGGGGGTATCCGG + Intronic
1189585840 X:42460971-42460993 TGGAGGTGCTGTGGGGCTGCAGG - Intergenic
1189752417 X:44235930-44235952 GGGGGTTGCTGGGGAGCTGGAGG - Intronic
1190298091 X:49040218-49040240 TGGGTGTGCAGGTGGGCTGGGGG + Intronic
1190302699 X:49065683-49065705 TGGGCTGGCAGAGGGTCTGCTGG + Intronic
1190718649 X:53127886-53127908 GGTGGTGGTAGGGGGGCTGCAGG + Intergenic
1191866282 X:65706429-65706451 TGGGCTTTCAGTGGGGCTGCTGG - Intronic
1192656938 X:73002819-73002841 TGTGGCTGCTGCGGGGCTGCGGG - Intergenic
1192665182 X:73080182-73080204 TGTGGCTGCTGCGGGGCTGCGGG + Intergenic
1192724045 X:73729017-73729039 TTGGGTTGCAGGGGGGATGGGGG - Intergenic
1193330683 X:80232546-80232568 TGGGGTTGGGGGGTGGCTGATGG + Intergenic
1193874840 X:86849615-86849637 TGGGGATGCAGGGGGAAGGCTGG - Intergenic
1196936145 X:120733038-120733060 TGGTGTTTCAGGGGAGCGGCTGG + Intergenic
1197311641 X:124912519-124912541 TGGTGTTGCAGGTGGGCTCTGGG - Intronic
1198911496 X:141620039-141620061 TGGGGATGCAGAGAGGCTGAAGG - Intronic
1199991241 X:152988773-152988795 TGGGGTGGGAGGTGGTCTGCTGG - Intergenic
1199992061 X:152992998-152993020 GGTGGGGGCAGGGGGGCTGCTGG + Intronic
1200059931 X:153479674-153479696 TGGGGGTGAAGTGGGGTTGCTGG + Intronic
1200236973 X:154472450-154472472 TGGGTTTGTACAGGGGCTGCGGG + Intronic
1201310946 Y:12597792-12597814 AGGGGTAGCAAGGGGGCTGGAGG + Intergenic