ID: 1075900891

View in Genome Browser
Species Human (GRCh38)
Location 10:126042055-126042077
Sequence TCCCCAAGGCCTCCTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075900891_1075900899 29 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900899 10:126042107-126042129 CACGGTCTCCATGTCATGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 109
1075900891_1075900893 5 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900893 10:126042083-126042105 GACCTCCTCTGCAGCAGCACTGG 0: 1
1: 0
2: 5
3: 24
4: 236
1075900891_1075900900 30 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900900 10:126042108-126042130 ACGGTCTCCATGTCATGGGAGGG 0: 1
1: 0
2: 2
3: 7
4: 93
1075900891_1075900896 11 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900896 10:126042089-126042111 CTCTGCAGCAGCACTGGTCACGG 0: 1
1: 0
2: 0
3: 26
4: 268
1075900891_1075900898 26 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900898 10:126042104-126042126 GGTCACGGTCTCCATGTCATGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1075900891_1075900897 25 Left 1075900891 10:126042055-126042077 CCAGTCACAGGAGGCCTTGGGGA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1075900897 10:126042103-126042125 TGGTCACGGTCTCCATGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075900891 Original CRISPR TCCCCAAGGCCTCCTGTGAC TGG (reversed) Intronic
900143749 1:1149394-1149416 TCCGCAAGGCCTCCTGTTTGGGG - Intergenic
901456015 1:9363271-9363293 TCACCCAGGCATCCTGTGAATGG - Intronic
901944282 1:12688809-12688831 GCCCCAAGCCCTCCAGTGAAAGG + Intergenic
902124168 1:14194547-14194569 TCCCCAAGGACTGCTGGGAGAGG - Intergenic
903237088 1:21957077-21957099 TCCCCAAGTCCACATGTGGCAGG + Intergenic
903660019 1:24971331-24971353 CCTCCAAGGCCTGCTGTGAGGGG + Intergenic
905527595 1:38650754-38650776 TCCCCATGGCCTCCTCTTCCAGG - Intergenic
905788444 1:40776426-40776448 TCCTCAAGGCCTCGTGTGCTAGG + Intergenic
906260088 1:44380456-44380478 TCCCCAACAACTCCTTTGACTGG + Intergenic
907315971 1:53572829-53572851 GCCCCAAGGCCTCCTGTCTCAGG + Intronic
912680557 1:111726435-111726457 AACCCCAGGCCTCCTGGGACTGG - Exonic
912697122 1:111849890-111849912 TGCTCCAGCCCTCCTGTGACAGG + Intronic
916188058 1:162152252-162152274 TCCCCCAGGCTCCCTGTGATGGG + Intronic
918814903 1:189169859-189169881 TCCCCAAGGAGACCTATGACTGG + Intergenic
919517253 1:198541192-198541214 CCCCCAAGGTCTCAGGTGACTGG + Intergenic
921339728 1:214122614-214122636 TTCCTAAGGGCTCCTGTGGCAGG - Intergenic
922594332 1:226802526-226802548 ACCCCAAGGCATCCGGTGATGGG - Intergenic
923136524 1:231124875-231124897 TCCCCATTGTCTCCTGTGACAGG + Intergenic
1066357423 10:34698399-34698421 TGCCCAAGGCCTCCAATGCCTGG + Intronic
1066987382 10:42479942-42479964 TCCCCAAAGCCTCCCGTACCTGG - Intergenic
1067093296 10:43282624-43282646 TCCCCACCACCTCTTGTGACAGG - Intergenic
1067525519 10:47036089-47036111 CCCCAAGGACCTCCTGTGACTGG + Intergenic
1067535716 10:47108459-47108481 TCCCTGATGCTTCCTGTGACCGG + Intergenic
1069847714 10:71384321-71384343 TCCCCAAGCCCTACTTTGAAGGG - Intergenic
1070931095 10:80261026-80261048 TCCCAAAGGCCTGGTCTGACAGG + Intergenic
1070971072 10:80567768-80567790 TCCCCTTGGCCTCCTCTGAAGGG + Intronic
1071451117 10:85792115-85792137 TCCCCAAATCCTCCTGCCACAGG + Intronic
1071933136 10:90496451-90496473 TGCCCAAGTCCTCCTGAGAGGGG - Intergenic
1073654094 10:105393650-105393672 GCCGCATGGCCTCCTGTGTCAGG + Intergenic
1075641991 10:124071309-124071331 GCCACAAGGCCACCTGTGATGGG - Intronic
1075900891 10:126042055-126042077 TCCCCAAGGCCTCCTGTGACTGG - Intronic
1076358626 10:129870665-129870687 TCCCCAGGGCCTGCGGGGACTGG + Intronic
1078022536 11:7667758-7667780 TCACCAAGGACCCCAGTGACAGG - Exonic
1080845498 11:36023344-36023366 TCCCCATGGCCCCCTGCAACAGG - Intronic
1081722728 11:45302074-45302096 TCCCAAAGGCCTGATGTGCCTGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1086899206 11:92347288-92347310 TCCTCAAGGACTCCTGTCAAGGG + Intergenic
1089158478 11:116420313-116420335 TCCCCAGGGCCTCCAGGGAAGGG - Intergenic
1090666242 11:128916743-128916765 TCCCTAAGACCTCCTGTCACTGG + Exonic
1091882475 12:3990793-3990815 TCGCCAAGGCCTGCTGGGGCAGG - Intergenic
1097681304 12:62651931-62651953 ACTCCAAGTTCTCCTGTGACTGG + Intronic
1098496796 12:71145048-71145070 CCCCCAAGGCCTGCTGTGTCTGG - Intronic
1100222502 12:92520922-92520944 TCCACAAGTCCTCCTGTGAAAGG - Intergenic
1101224451 12:102674030-102674052 TCCCCAAGGACTTCTGTGCTGGG + Intergenic
1102255870 12:111414697-111414719 CCACCATGGCCTCATGTGACAGG + Intronic
1102413891 12:112743776-112743798 TGCCCAAAGCCTCCTCTTACTGG - Intronic
1102563402 12:113778883-113778905 TCCCCATCTCCTCCTGGGACGGG + Intergenic
1103033043 12:117633397-117633419 TGCCCAAGGGCTCCTGGGTCAGG + Intronic
1103651616 12:122437387-122437409 TCCCCATTGACTCCTGTGCCTGG - Intergenic
1103839455 12:123850702-123850724 TCCCCAAGGCCTTCAGCGAGGGG + Intronic
1103932458 12:124457880-124457902 CCCTCCAGGCCTCCTGTGAGTGG - Intronic
1105773968 13:23639430-23639452 TCCCCAAGGACACCTGCTACGGG - Intronic
1108065474 13:46573020-46573042 TCCCCAAAGCCCTCTGTGACAGG - Intronic
1109636305 13:65122509-65122531 TCCCCAAGTCCCCCTCCGACAGG + Intergenic
1113016693 13:105835885-105835907 GCCACTAGGCCTCCTGTGATGGG + Intergenic
1113848491 13:113405147-113405169 TCCCCAGGTCCGCCTGTGTCAGG + Intergenic
1113964446 13:114144706-114144728 CCTCCAAGGCCGCCTCTGACTGG + Intergenic
1117298342 14:54398467-54398489 TGTCCATGGCCACCTGTGACTGG + Intronic
1120223763 14:81766786-81766808 CACCCCAGGCATCCTGTGACAGG + Intergenic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1122356501 14:101125997-101126019 TCCTGGAGGCCTCTTGTGACTGG + Intergenic
1122820887 14:104344238-104344260 TCCCAGAGGCCTCCTCTGTCAGG + Intergenic
1124664643 15:31581747-31581769 GCCTCCAGGCCTCCTGTGATGGG + Intronic
1124809286 15:32918576-32918598 TGCCCAAGGTCTCCTTTTACAGG + Intronic
1124957090 15:34366901-34366923 TCCCCAAGCCCACCTTTGCCAGG + Intronic
1125117222 15:36108758-36108780 TCCCCTAGGGCTCCTGAGACTGG - Intergenic
1125716098 15:41820828-41820850 ACCCCACGGACTCCTGTGCCTGG - Exonic
1127136015 15:55924391-55924413 TACTCAAGACCTCTTGTGACAGG - Intronic
1130902650 15:88218776-88218798 GCATCAGGGCCTCCTGTGACCGG - Intronic
1132601598 16:775369-775391 GCCCCCAGGACTCCTGTGGCCGG + Intronic
1132679506 16:1133971-1133993 TTCCTGAGGCCTCCTGTGTCTGG - Intergenic
1132735209 16:1382516-1382538 TCCCCATGGCCTCCTGAGGGAGG + Intronic
1132861600 16:2074463-2074485 TCCCCAAGGAGTCCTGAGAGAGG - Intronic
1133442464 16:5832234-5832256 GCCCCAGGGCCTCCTGAAACAGG + Intergenic
1139588242 16:67918029-67918051 TCCTCCAGGCCTCCTGTGATAGG - Intronic
1139958144 16:70703056-70703078 TCCCCAGTGCCTGCTGTGAGTGG + Intronic
1140192552 16:72830269-72830291 TTCCCAAAGCCTCCTGGTACTGG + Intronic
1140213879 16:72992213-72992235 TCCTCCAGGCCTCCTGAGAAAGG + Intronic
1140852032 16:78943921-78943943 TACCCAAGGCCTCCATTGCCTGG + Intronic
1141455060 16:84135914-84135936 TCCCCAAGGGCTCCTGGGATTGG - Intronic
1141794227 16:86259160-86259182 TCCCTGAGGCCTCCTGTGAGTGG + Intergenic
1141998162 16:87648065-87648087 TCCCCCAGCCCTGCTGTGACAGG + Intronic
1142074356 16:88108788-88108810 TCCCCAAGACCTCCTGCTCCAGG + Intronic
1143165480 17:4895328-4895350 TGCCCAAGGGCTCCTGTTGCAGG + Exonic
1143491251 17:7286416-7286438 GCCCCATAGCCTCCTGGGACAGG - Exonic
1146497621 17:33337087-33337109 TCTCCAAGGCCCTCTGTGAGGGG - Intronic
1147669203 17:42167071-42167093 TCCCCCTGGGCTCCTGTGAAGGG + Intronic
1148437813 17:47696145-47696167 GCCCCAGGGCCTCCTGCGTCAGG - Exonic
1148863007 17:50614314-50614336 CCCCCTAGACCTCCTGAGACGGG + Intronic
1150313302 17:64147036-64147058 TCCACAAGGGCTCCAGTGAAAGG + Intergenic
1150749915 17:67851201-67851223 TCACGAAGGCCCCTTGTGACTGG - Intronic
1151927918 17:77212420-77212442 TCCCAAAAGCAGCCTGTGACAGG + Intronic
1153829912 18:8912900-8912922 TCCCCAGAGCCGCCTGTTACCGG + Intergenic
1159384697 18:67708057-67708079 TCTCCTAGGCCTCCTGGGTCAGG + Intergenic
1159926972 18:74278167-74278189 TCCCCAGGGCCTCCCCTAACTGG - Intronic
1160720003 19:592885-592907 GGCCCAAGGCCTCCTGTGCCTGG + Intronic
1160785141 19:896798-896820 TCCCCCACGCCACCTGTGTCGGG - Exonic
1161994176 19:7702392-7702414 TCCCCAGGGCCCTCTGTGATCGG - Intergenic
1163276988 19:16291037-16291059 TCCCCCAGGCATCCTGTGTTGGG - Intergenic
1163406910 19:17128528-17128550 TCCCTCAGGCGTCCTGGGACAGG + Intronic
1165441656 19:35831683-35831705 TCTCCAATGCCTCCTGTGTCGGG - Exonic
1166731436 19:45061135-45061157 TCCTCAAGGCCTCCTGACCCAGG - Intronic
1167049279 19:47068781-47068803 TCCCTAAAGCCTCCTCTGGCAGG + Intronic
1167082131 19:47283590-47283612 TCCCCAAGGACTCCTGCTAAGGG + Intergenic
1167134955 19:47610271-47610293 TCCCCGCGGCCGCCCGTGACAGG - Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
1167596475 19:50430957-50430979 TCCCCAGGGCCCCCTGCAACGGG + Exonic
925142755 2:1561252-1561274 TCCCCACGGCCTGCTGTGTAGGG - Intergenic
927666075 2:25033724-25033746 TACTCAAGGCCTTCTGTGACTGG + Intergenic
927827168 2:26316929-26316951 TCCCCAAGGCCTCTTCTCACTGG - Exonic
929483830 2:42337878-42337900 TCCGCACTGCCTCCTCTGACTGG - Intronic
932459783 2:71874789-71874811 TCCCAAAGGCCTCCTCTCAAGGG - Intergenic
934855659 2:97727917-97727939 TCCCTAAAGCCTCCTGAGAGTGG + Intronic
934980576 2:98836514-98836536 TTTCCATGGGCTCCTGTGACAGG + Intronic
935067110 2:99658765-99658787 TCACCATGGACTCCTGTGGCTGG + Intronic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
939654867 2:144811445-144811467 TCCCCAAAGCCTCTCTTGACCGG - Intergenic
941952215 2:171167306-171167328 TCAACAAGGCCTCCTCTGCCTGG + Intronic
942221787 2:173775993-173776015 CTTCCAAGGCCACCTGTGACTGG + Intergenic
945195231 2:207231346-207231368 TCCCCAAGGCCTCCTTGGGGAGG - Intergenic
946180860 2:217948225-217948247 TCCCCAACTCTTCCTGTGATGGG + Intronic
946634184 2:221706471-221706493 TCCTCAAGGGCTCCTGCGAGAGG - Intergenic
947627983 2:231633081-231633103 ACCCCAGGGCCTCCTGAGATGGG - Intergenic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
1168850456 20:973127-973149 TGTCCAGGGCCTCCTGTGTCAGG + Intronic
1169119278 20:3085403-3085425 TCCCCAAGGCCCCCAGTTTCAGG - Intergenic
1171036001 20:21713543-21713565 TCCCCAAGTCCTCCTTTAAAGGG - Intronic
1172444897 20:34987787-34987809 TGGCCAAGGCCACCTATGACCGG + Exonic
1175396988 20:58671981-58672003 TACACAAGACCTCATGTGACAGG + Intronic
1175757669 20:61539738-61539760 CCCCCAAGCCCTGCTGTCACAGG + Intronic
1175805535 20:61826439-61826461 TCAGCAAGGCCTTCTCTGACAGG - Intronic
1175956484 20:62612314-62612336 TGCCCAAGGCCCCCTGTGCCTGG - Intergenic
1176006900 20:62870294-62870316 TCCCCCAGGCCTCTTGTAAAAGG + Intergenic
1176011142 20:62896612-62896634 GCCCCAAGGCGTCCTGGGGCTGG + Exonic
1176147545 20:63572217-63572239 TCTCGAAGGCCTCCTGAGAGTGG + Exonic
1176180814 20:63748502-63748524 CCCCCAAGGCCTCCTCTAGCTGG - Intronic
1180073199 21:45449011-45449033 TCCCCGTGGCCTCCTGTCAGGGG + Intronic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1182555446 22:31126295-31126317 TCCCCAGGGAGTCCTGTGAAAGG + Intronic
1183976845 22:41517329-41517351 TCCCCATGGCCTCCCCTCACCGG + Intronic
1185295594 22:50052193-50052215 TCCCCAAAGCCTCGGGTGATAGG - Intronic
949891004 3:8733680-8733702 TCTCTAAAGCCTCCTGTGGCAGG - Intronic
950342868 3:12263042-12263064 ACCCCAGAGCCTCCTGTGCCTGG - Intergenic
950626130 3:14248490-14248512 TCCACAGGGCCTGGTGTGACTGG + Intergenic
952307322 3:32157698-32157720 TCCACAAGGCCTCTTCTGTCTGG - Intronic
957367536 3:79245722-79245744 CCCCCAAGGTCTCCAGTGAAAGG - Intronic
961318582 3:126057055-126057077 TCCCCAGGCCCTCCTCTGCCAGG - Intronic
967220683 3:187245631-187245653 TGCTCAAGGCCTCTTGTGAGGGG - Intronic
968506918 4:974952-974974 GCCCCAAGACCCCCTGTGCCTGG + Intronic
968747738 4:2369606-2369628 TCTCTAAGGCCACCTGTCACTGG - Intronic
971267885 4:25110937-25110959 TGCCCAGGGCCTGCTGTGGCAGG + Intergenic
973316565 4:48766586-48766608 TACTCAGGGCCCCCTGTGACTGG - Intronic
974405703 4:61465861-61465883 TCCCCAAGTCCTCGGGTTACAGG - Intronic
975718424 4:77227712-77227734 TCCCCAAGGACCCCTGTGAGAGG + Intronic
976496093 4:85731563-85731585 TTCCCAGTGCCTCCTGAGACTGG + Intronic
977697369 4:99981645-99981667 TCCCCTCGCCCTCCTGAGACAGG + Intergenic
979786065 4:124716898-124716920 TCCCCTATGCATCCTTTGACTGG + Intergenic
980206968 4:129732643-129732665 TCCCCAATGGCTCCAGCGACCGG + Intergenic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
984744082 4:183196651-183196673 TCCTAAAGGCCTCCAGTGCCAGG - Intronic
985629287 5:1006372-1006394 TCCCCCAGGGCTCCTCTGAGTGG - Intergenic
985651538 5:1109944-1109966 TCCCAAAGGCCTTCTGTGTGGGG - Intronic
986423041 5:7603207-7603229 TTCCCAGGCTCTCCTGTGACTGG - Intronic
988609972 5:32714154-32714176 TTCCCAAGGCCGGCTGGGACTGG + Intronic
990449224 5:55919367-55919389 TCCCCAATGGCTCCTGTGAGTGG + Intronic
992170532 5:74097293-74097315 TCCCCCAGGCTTCCTGTCCCTGG - Intergenic
995354539 5:111223763-111223785 TCCCTCAGGGCTCCTGTGCCTGG - Intronic
997248725 5:132372519-132372541 TCCCAAAGGCCAGCTGTGCCAGG + Intronic
997602438 5:135149839-135149861 TCCTAAAAGTCTCCTGTGACAGG - Intronic
998354262 5:141521550-141521572 TCCCCCAGGTCTCCAGAGACCGG + Intronic
1001285730 5:170422417-170422439 TACCCAAGGACTTCAGTGACTGG + Intronic
1002044990 5:176536760-176536782 CCCCCAAGGCCCCCCGTGGCCGG - Intronic
1006669967 6:35724117-35724139 TCCCAAAGGCCTGCTGTAAACGG + Intronic
1007664494 6:43506328-43506350 TCCCCAAGGCCAGCTGTGCCAGG - Exonic
1012162582 6:95904771-95904793 TTTCCACTGCCTCCTGTGACAGG - Intergenic
1012171542 6:96022909-96022931 TCCCAAAGGGCTCCTGTGAATGG + Intronic
1014491119 6:122063199-122063221 TCCCCTGGGGCTCCTGTTACAGG - Intergenic
1015729799 6:136335833-136335855 TCCCCAGGGCCGCCTTTGCCTGG + Intergenic
1016063586 6:139655686-139655708 TGCCCTAGGCCACCTGTGGCAGG + Intergenic
1016251003 6:142042870-142042892 TCCCCAAGCTCTCTTGTCACTGG - Intergenic
1017733565 6:157339692-157339714 TGTCCCAGCCCTCCTGTGACTGG - Intergenic
1018186865 6:161273313-161273335 TCCCCCACCCCTCCTGTGATAGG + Intronic
1019622147 7:1997808-1997830 TCCCCAGGACCTCCTCTGAAGGG + Intronic
1020265253 7:6556264-6556286 TTCCCCAGGCCTCCTGGGAGAGG - Intergenic
1022521284 7:31008660-31008682 TTCCCAATGCCTCCTGTCCCGGG + Intergenic
1022763294 7:33380782-33380804 TCCACAAGGCCTGGTGCGACAGG + Intronic
1023022003 7:36019122-36019144 GCCCCAAGGACTCCTGAGAGAGG - Intergenic
1023082312 7:36537038-36537060 ATCCCCAGGCCTCCTTTGACAGG - Intronic
1023874997 7:44282116-44282138 TCTCCATGGCACCCTGTGACAGG + Intronic
1024083105 7:45872520-45872542 TTCCAAAGGCCTCATGAGACAGG + Intergenic
1024633643 7:51269111-51269133 TCCCCAAGCACTCCTGGGATGGG + Intronic
1024760758 7:52593961-52593983 TGCCCCTGGCCTCCTGTGGCTGG - Intergenic
1030058945 7:105607785-105607807 TCCCCATGGCCTCCTCGGATGGG + Exonic
1032744236 7:134770178-134770200 TTTCCCAGGCCTCATGTGACGGG - Intronic
1036053854 8:5228779-5228801 TCCCCAATACCTCCTGTGGTAGG - Intergenic
1041627616 8:60048463-60048485 TCCACAATGCCTTCTGTGACAGG + Intergenic
1041779002 8:61557275-61557297 CCCCCAAGGCCTCCCTTGGCTGG + Intronic
1042059436 8:64800690-64800712 ACCCCAAGCCCTCCTTTGAAGGG - Intergenic
1049581439 8:143412928-143412950 TCCCCAGGGTCCCCTGTGGCTGG - Intergenic
1052985921 9:34487783-34487805 TCCCAATAGCCTCCCGTGACTGG + Intronic
1056720582 9:89068198-89068220 TCCCCAAGACCCCCTGTGCCTGG + Intronic
1056810071 9:89757327-89757349 TCCCCCAGGTCTCTTGTGCCTGG + Intergenic
1059431724 9:114254505-114254527 TCCCCAAGCCCACCTCGGACTGG - Intronic
1060482289 9:124023657-124023679 TCCCCAAGGCCAACAGAGACTGG - Intronic
1061042771 9:128149528-128149550 GCCCCTAGGTCTCCTGTGGCTGG + Exonic
1061545866 9:131304000-131304022 TCCCCAAGGTCACCTGAGATGGG + Intronic
1061713648 9:132504977-132504999 TCCCCAACACCTCCTCTGTCGGG - Intronic
1189316828 X:40062532-40062554 CCCCCAAACCCTCCTTTGACAGG - Intronic
1189554916 X:42132337-42132359 TCCTCAAAGCCTCCTGGGATGGG + Intergenic
1190742413 X:53298284-53298306 TCCCCAGGGCTTCCTGAGAAAGG + Intronic
1198337820 X:135684625-135684647 ACCCCCAGGCCTCCCCTGACAGG - Intergenic
1199860674 X:151798175-151798197 TCCCCAAGGCCTCCTGGATGAGG - Intergenic
1200059912 X:153479620-153479642 GCCCCAGTGCCTCCTGAGACAGG + Intronic
1200710573 Y:6481318-6481340 GCCCCAAGGCCTCCTGCTGCAGG - Intergenic
1201574010 Y:15442739-15442761 TCCCGAGGGGCTCCTGTGACTGG - Intergenic