ID: 1075903017

View in Genome Browser
Species Human (GRCh38)
Location 10:126058142-126058164
Sequence CCTTGGGAGGAGGGAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 0, 2: 11, 3: 103, 4: 833}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075903017_1075903028 24 Left 1075903017 10:126058142-126058164 CCCTCCTTTCCCTCCTCCCAAGG 0: 1
1: 0
2: 11
3: 103
4: 833
Right 1075903028 10:126058189-126058211 ACTTGCTTTTGCCTCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075903017 Original CRISPR CCTTGGGAGGAGGGAAAGGA GGG (reversed) Intronic
900146281 1:1160250-1160272 CGCAGGGAGGAGGGAAGGGAAGG + Intergenic
900189274 1:1346430-1346452 CCTTGGGCCGAGGCAGAGGAGGG - Intronic
900205511 1:1430539-1430561 CCCGGGCAGGAGGGGAAGGAAGG - Intergenic
900268976 1:1777603-1777625 CTTGGGGAGGAGGGATGGGAGGG + Intronic
900420675 1:2554750-2554772 CCTGGGGAGGAGGGAAACTGAGG - Intergenic
900912170 1:5606210-5606232 GCTGAGGAGGAGGGAGAGGAGGG + Intergenic
900972429 1:5998949-5998971 CCGTGAAAGGAGGAAAAGGAAGG + Intronic
900997508 1:6130373-6130395 CCTTGGGTGGGCAGAAAGGATGG + Intronic
901333836 1:8431560-8431582 CCATGGGCTGAGGGGAAGGATGG - Intronic
901654577 1:10762099-10762121 CCTTGGGAGGCAGGAGGGGAGGG - Intronic
902380566 1:16050462-16050484 CCTTGGGATGTGGGAAAGGGAGG + Intronic
902550183 1:17214726-17214748 CCTTGGGAGGTGTGACAGGCAGG - Intronic
902636948 1:17740885-17740907 CCTGGGGAGAGGGGAAAGGCGGG - Intergenic
902782300 1:18712460-18712482 TCCTGGGTGGAGGGAAATGAGGG + Intronic
902883480 1:19388373-19388395 ATTTGGGAGGAAGGAAAGAAAGG + Intronic
903128093 1:21261297-21261319 TCTTTGAAGGAGGCAAAGGAAGG - Intronic
903575066 1:24334624-24334646 CCCTGAGAAGAGAGAAAGGAAGG - Exonic
903652762 1:24931396-24931418 ACTTAGGAGGCGGGAGAGGAAGG - Intronic
903662070 1:24984376-24984398 CCTGGAGAGTAGGGATAGGAAGG + Intergenic
903735712 1:25528815-25528837 CCTTGGAAGAGGGGAAAGGTTGG - Intergenic
903953474 1:27009973-27009995 CCTTGGCATGGGAGAAAGGAGGG - Intronic
904357726 1:29951885-29951907 CCTTGGCAGGTGGTAGAGGAAGG + Intergenic
904615001 1:31744806-31744828 CCTCAGGCGGAGGGCAAGGAAGG - Intronic
904733559 1:32613008-32613030 CTTTGGGAGGAGGAAGTGGAAGG + Intronic
904945338 1:34195057-34195079 CATGGGAAGGAGGCAAAGGAAGG + Intronic
905276939 1:36824513-36824535 GCGTGGGAGGAGGGAGCGGAAGG + Intronic
905475322 1:38222578-38222600 ACTTGGGAGAAGGGAAGGAAGGG + Intergenic
905791388 1:40791530-40791552 CCTGGGGATGAGGCACAGGAGGG + Intronic
906134152 1:43483791-43483813 CTTTGGGAGGCTGGAAAGGGAGG - Intergenic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906295641 1:44647427-44647449 GCTTGTGAGGAGGGAAGGGATGG + Intronic
907321676 1:53606582-53606604 TTTTGTGAGGAGGGAAAAGAGGG - Intronic
907585235 1:55610983-55611005 CCTGGGTTGGAGGGAAAGAAAGG + Intergenic
907601585 1:55776460-55776482 TCTTAGGAGGAGTGATAGGAAGG + Intergenic
907761013 1:57359935-57359957 GCTTGGGAGTGGGGGAAGGATGG + Intronic
908216980 1:61964105-61964127 CCTTGGTAACAGAGAAAGGAAGG - Intronic
908356198 1:63326758-63326780 CCCTGGGAAAAGGGAAAGGCAGG + Intergenic
909408404 1:75319219-75319241 GATTGGGGGTAGGGAAAGGAAGG - Intronic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
910081463 1:83347594-83347616 CCTGGAGAGGTGGGAGAGGAAGG - Intergenic
910223255 1:84911042-84911064 ACTTGGGAGGTGGGATAAGAAGG - Intergenic
911093503 1:94036689-94036711 ACTTGGGAGGGAGGCAAGGAAGG + Intronic
912275755 1:108256621-108256643 CCTGGGAAGGAAGGAAAGGAAGG - Intergenic
912292472 1:108437733-108437755 CCTGGGAAGGAAGGAAAGGAAGG + Intronic
913456691 1:119039233-119039255 CCTTGAGGGAAAGGAAAGGAAGG - Intronic
913497635 1:119443052-119443074 CCTGGGGAGGAGATAAAGCAAGG + Intergenic
914001949 1:143702049-143702071 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
915017029 1:152743853-152743875 GCCAGGGAGGAGGGGAAGGATGG + Intronic
915228352 1:154427800-154427822 CCTTGGATGGGGTGAAAGGAAGG + Intronic
915312054 1:155009805-155009827 CCTGGGAAGAAGGGAATGGATGG + Intronic
915334100 1:155130456-155130478 CCTTGGGAGGAGGGGAGAGGAGG + Intronic
915597637 1:156904582-156904604 ACTTGAGAGGTGGGACAGGATGG + Intronic
915914165 1:159931261-159931283 CCTAGGCAGGGGGGAATGGAGGG + Exonic
915938111 1:160100750-160100772 GCTTGGGAGGAGGGACAGTGAGG - Intergenic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
916051007 1:161037161-161037183 CCTTTGGGTGAGGGAATGGATGG - Intronic
916086381 1:161273051-161273073 CATGGGGAAGAAGGAAAGGAAGG - Intronic
916128017 1:161588612-161588634 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916137935 1:161670442-161670464 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916560434 1:165930155-165930177 TGTGGGGAGGAGGGAAGGGAAGG + Intergenic
916611797 1:166398700-166398722 CTGTGGGAGGTGGGATAGGAGGG - Intergenic
917537128 1:175882447-175882469 CAGTGGCAGGAGGGAAGGGAGGG + Intergenic
918084496 1:181234122-181234144 ACTGGGGAGGAGAGAAAAGAGGG + Intergenic
918245584 1:182656717-182656739 GCTTGAGAGATGGGAAAGGAGGG + Intronic
918482864 1:184998372-184998394 GGTTGTGAGGAGGGAGAGGATGG + Intergenic
919008287 1:191928166-191928188 CCTGGGGGTGAGGGAAAGGATGG - Intergenic
919430455 1:197485753-197485775 CCAAGGGAGTAGGGAAAGGGTGG - Intergenic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920702303 1:208226831-208226853 CCTTTGGGGGAGGGTCAGGAAGG + Intronic
920716336 1:208343812-208343834 CCTGGGAAGGAGGCACAGGATGG - Intergenic
920997609 1:211010284-211010306 GAATGGGAGGAGGGAAAGCAGGG + Intronic
921067432 1:211632766-211632788 CCATAGGAGGAGGAACAGGAAGG - Intergenic
921080848 1:211737454-211737476 CCTTGGCAGGAGGGACAACAAGG + Intergenic
921482895 1:215683828-215683850 CATTAGGAAGAGTGAAAGGAAGG - Intronic
921552663 1:216556882-216556904 GCATGGAAGGAAGGAAAGGAAGG + Intronic
922116180 1:222617380-222617402 CCCTGGGAGGCTGAAAAGGAGGG + Intergenic
922481371 1:225941741-225941763 TCATGGGGGGAGGGCAAGGACGG - Intergenic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
923073950 1:230592522-230592544 CCTTGGGGAGAGGGATAGGATGG - Intergenic
923501041 1:234564634-234564656 GCTTGGTGGGAGGGAAGGGATGG + Intergenic
923624979 1:235606512-235606534 GCTGGGGAGGGGGGAAAGGAAGG + Intronic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924159042 1:241211039-241211061 CTTTGGGAGGACGAGAAGGATGG + Intronic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063531772 10:6840127-6840149 CCAAGGCAGGAGGGAAATGATGG - Intergenic
1063703152 10:8405173-8405195 CTTTGAGAGGCGGGAAAAGAGGG - Intergenic
1064099521 10:12451366-12451388 CCTTGGGAGGAGGAAGAGGTAGG + Intronic
1064128644 10:12687858-12687880 CCTTGGGAGGAAGGAACAGGAGG - Intronic
1064178339 10:13094877-13094899 ACATGGGAGGAAGGAGAGGAAGG + Intronic
1064568968 10:16672707-16672729 CCTGGGGATGGGGGAAATGAAGG + Intronic
1065169189 10:23010445-23010467 AGGAGGGAGGAGGGAAAGGAAGG - Intronic
1065169196 10:23010465-23010487 AGGAGGGAGGAGGGAAAGGAAGG - Intronic
1065486037 10:26237334-26237356 CCTTGGGAGGTGGCAGAGCAGGG - Intronic
1065842058 10:29710298-29710320 CTTTGGGAGGAGGCCAAGGTGGG - Intronic
1066004280 10:31133053-31133075 CCTGGGGAGGGAGGAAGGGAGGG - Intergenic
1066005993 10:31146616-31146638 CTTTCGGAGTTGGGAAAGGAGGG + Intergenic
1066045687 10:31593820-31593842 CCGTGGGACGAGGGAAATGATGG + Intergenic
1066433183 10:35372168-35372190 ACTCTGGAGGAGGGAAAGGATGG + Intronic
1066471167 10:35699693-35699715 CCTGGGGAGAATGGAAAGGTTGG - Intergenic
1066500509 10:35989124-35989146 CCTTAAGAGGAGGGAACTGAGGG + Intergenic
1067179929 10:43977451-43977473 CTATGGGAGAAGGGTAAGGATGG + Intergenic
1067788622 10:49271173-49271195 CCTGGGGAGAGGGGAGAGGAAGG + Intergenic
1067979410 10:51067176-51067198 CTGTGGGAGGTGGGATAGGATGG + Intronic
1069263179 10:66425580-66425602 ACTTGGGAGAAGGAAGAGGAAGG - Intronic
1069926049 10:71851414-71851436 CAATGGGAGGGGCGAAAGGAAGG + Intergenic
1070610173 10:77927110-77927132 CCTGGGGAGGGGAGAGAGGAGGG - Intergenic
1071476692 10:86031691-86031713 TGGTGGGAGAAGGGAAAGGAAGG - Intronic
1071545247 10:86523935-86523957 CGTTAGGATGAGGGAGAGGAAGG + Intergenic
1071669610 10:87596456-87596478 CATTGGGAGGGGTGTAAGGAGGG - Intergenic
1071737533 10:88318317-88318339 CCTTGGGACAAAGGAAATGAAGG + Intronic
1072268851 10:93756035-93756057 TCTGTGGAGGAGGGAATGGAGGG - Intergenic
1072430770 10:95368952-95368974 CCGTGGGAGGAAGGAAGGGAGGG - Intronic
1072532181 10:96329932-96329954 CCTGGGGAGGATGGGAAGGATGG + Intronic
1072804830 10:98417726-98417748 CCTGGGGAGGAAGGGGAGGATGG + Exonic
1073322120 10:102621707-102621729 CCCTGAGAGGAGGAAAGGGAGGG + Intronic
1073893182 10:108123751-108123773 CTGTGGAAGGAAGGAAAGGAAGG + Intergenic
1074104156 10:110376309-110376331 CCTGGGGAGGAGGGCAAGGGTGG - Intergenic
1074420317 10:113302811-113302833 AGTTAGGAGGAGGGAATGGATGG - Intergenic
1074718243 10:116240561-116240583 ACTTGGGCGGAGTGAAACGAAGG + Intronic
1074869327 10:117564686-117564708 CAATGGGTGGAGAGAAAGGAGGG + Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075088014 10:119426443-119426465 CCTTGGGAAGAGGCAGAGGCGGG - Intronic
1075171892 10:120123079-120123101 GCCTGAGATGAGGGAAAGGAAGG + Intergenic
1075840547 10:125498708-125498730 GGGTGGGAGGAGGGAGAGGAAGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1075933491 10:126319868-126319890 TCTTGGGAGGATGGAAGGGTGGG + Intronic
1076325534 10:129617909-129617931 ACATGGGAGGAGCCAAAGGATGG + Intronic
1076378220 10:130006714-130006736 GAAAGGGAGGAGGGAAAGGAGGG + Intergenic
1076572426 10:131441366-131441388 AGTAAGGAGGAGGGAAAGGATGG + Intergenic
1077264686 11:1642820-1642842 CCCTGGGAGGGAGGGAAGGAGGG - Intergenic
1077340036 11:2022129-2022151 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1077693417 11:4370408-4370430 ACTTGGGAAGAGGGCAAGGCTGG - Intergenic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1077899609 11:6478262-6478284 CCCGGGGAGGAGGGGAATGAAGG - Intronic
1077955195 11:7011044-7011066 CCTTGGGATTAGGGAGAGGGAGG - Intronic
1077993913 11:7436368-7436390 CCTTGGAGGGAGGGAAAGTGGGG + Intronic
1078258922 11:9685876-9685898 CTTTGGGAGGAGGCCAAGGAAGG - Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078982488 11:16552390-16552412 ATTTGGGAGGGGGGAAATGAGGG - Intronic
1078986489 11:16604256-16604278 CATGGCGAGGAGGGACAGGACGG - Intronic
1079173751 11:18120468-18120490 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1080077223 11:28164848-28164870 CCTGGGGAGGAGGGAAGAAATGG - Intronic
1080353023 11:31406822-31406844 TCATGGGAGGAGGGAAAGAGGGG + Intronic
1080844434 11:36014548-36014570 CCATGGCAGGCGGGAAAGGAGGG - Intronic
1081651940 11:44830034-44830056 CCTTGTGAGGAGGGCAGGGGTGG - Intronic
1081759863 11:45569671-45569693 TCTGGGGAGGAGGGGAAGGGAGG + Intergenic
1082668992 11:56010525-56010547 GGCTGGGAGGAGGGTAAGGATGG + Intergenic
1083292538 11:61697929-61697951 CCAGGGGAGGAGGAAATGGAGGG - Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1083727727 11:64637142-64637164 CCCTGGGAGGAAGGGCAGGAGGG + Intronic
1083781957 11:64923383-64923405 GCCTGGGAGGTGGGCAAGGAGGG + Intronic
1083827617 11:65212177-65212199 CCCTGGGAGGTTGGGAAGGAGGG + Intergenic
1083862550 11:65430215-65430237 CCAGGGGAGGCGGGGAAGGAGGG - Intergenic
1084040979 11:66542608-66542630 ACATGGGAGGAGGGAAAGGAAGG + Intronic
1084156405 11:67315522-67315544 CCTTGGGGCAAGGGAGAGGAGGG - Intergenic
1084173204 11:67410368-67410390 CCCTGGAGGGAGGGGAAGGAGGG - Intronic
1084273099 11:68039285-68039307 CCAAGGGAGGAGGAGAAGGATGG + Intronic
1084500099 11:69530325-69530347 CCTGGGGAGGAGGGAAAGAAGGG + Intergenic
1084529196 11:69717131-69717153 CCTTGCAAGGAGGCAAAGCATGG - Intergenic
1084624634 11:70296709-70296731 CCATGGGGAGAGGGAGAGGAGGG + Intronic
1084854886 11:71976948-71976970 GCTTGTGGGGAGGGAAAGGGAGG - Intronic
1084890334 11:72233587-72233609 CCTTGGGAGGTGGGAGCCGAGGG + Intronic
1084892082 11:72241578-72241600 GCTTGGGAGGAGGGCGACGACGG - Intronic
1084944382 11:72630973-72630995 CCTTGGGAGGACGGGGAGGCTGG - Intronic
1085135382 11:74082681-74082703 CCTTTGGGGGAGGGACAGGGGGG - Intronic
1085296240 11:75433299-75433321 CCTGGGAGGGAGGGAAAGAAAGG + Intergenic
1085654912 11:78305133-78305155 CCTTATGAGTAGGGAAAGAAAGG + Intronic
1086068448 11:82771591-82771613 CTTTGGGAGGAGGGTGAGGCAGG - Intergenic
1086291709 11:85317766-85317788 GGGTAGGAGGAGGGAAAGGATGG + Intronic
1086430346 11:86731551-86731573 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1086753954 11:90534675-90534697 ACTTGGAAGGAAGGAAAGGAAGG + Intergenic
1087024150 11:93633324-93633346 CCCTGGGAGGATGGTAAAGAAGG + Intergenic
1087544327 11:99565220-99565242 CCTTGGGAGGAGAGAAACAAGGG - Intronic
1087805723 11:102553059-102553081 ATTTGGAAGGAGGGAAAGGATGG - Intergenic
1087807484 11:102570448-102570470 CCTGGGGAGGAGTGAAGGAAGGG - Intergenic
1088142707 11:106636695-106636717 CCCTGGGAAGAGGGAATGTAGGG - Intergenic
1088233313 11:107696361-107696383 CCTTGAGAGTAGGGAAAGATAGG + Intergenic
1088548537 11:110986656-110986678 CTTTGAGAGGAGGAAAAGGTAGG + Intergenic
1088817274 11:113430156-113430178 CCTTGGGAGGAAGTAAAGGAAGG + Intronic
1088934504 11:114385527-114385549 CCTTTGGAGGAGGTACATGATGG - Intergenic
1089297959 11:117481132-117481154 CCTGGGGAGGTGGGATGGGAAGG + Intronic
1089395609 11:118134948-118134970 CCTGGGGAGGAAAGAGAGGATGG + Exonic
1089540284 11:119185719-119185741 ACTTGGGGGGAGAGAAAGGGAGG + Intronic
1090332615 11:125943399-125943421 CCTTGGGAAGGGGGGAAGGAGGG + Intergenic
1090359459 11:126162515-126162537 GCTGGGGAGAAGGGAAAGGAAGG + Intergenic
1090807320 11:130210562-130210584 CCCTGGTAGGAGGGAAATGCGGG + Intergenic
1090844109 11:130516667-130516689 CCTTCTGAGGAGGCAAAGCATGG + Intergenic
1091168658 11:133501926-133501948 GCTTTGAAGGAGGGAAAGGCAGG - Intronic
1091189136 11:133675364-133675386 TCTTGGTAGGAGTGACAGGAAGG - Intergenic
1202823021 11_KI270721v1_random:77318-77340 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1091672444 12:2462083-2462105 GCTGGTGAGGAGGGAGAGGAGGG - Intronic
1091832255 12:3558046-3558068 CCTAGGGAGGAGGGAGACCAGGG - Intronic
1091833563 12:3568258-3568280 GCTGAGGAGGAGGGAGAGGAAGG + Intronic
1092001763 12:5038631-5038653 CCCGTGGAGGAGGGAAGGGAAGG + Intergenic
1092171802 12:6378119-6378141 CCCTTTGGGGAGGGAAAGGAAGG - Intronic
1092253847 12:6915796-6915818 CCTCGGGTGGAAGGGAAGGAAGG - Exonic
1092851542 12:12633043-12633065 ACTTGGGAGGAGGCCAAGGCAGG - Intronic
1092953589 12:13529694-13529716 TGTTGGAAGGAAGGAAAGGAGGG + Intergenic
1094211599 12:27899101-27899123 CTTTGGGAACAGGGAGAGGATGG - Intergenic
1095485190 12:42677315-42677337 ACTTGAGAGTAGGGAAATGAGGG - Intergenic
1095531339 12:43190146-43190168 CTTTGGGAGGAGGCAAAGGTGGG - Intergenic
1096335184 12:50749869-50749891 GCATGGGAGGAGGGACAGAAAGG - Intergenic
1096370206 12:51063250-51063272 TCTAGGGAGGAGGGAGTGGAAGG - Exonic
1096700598 12:53380429-53380451 CCCGGGGCGGAGGGAAGGGAGGG + Intronic
1096837318 12:54359081-54359103 CCTTGAGGGGAGGGAAAGAGGGG + Intergenic
1096992947 12:55819696-55819718 CCTTGGTAGTAAGGAAATGAAGG + Intronic
1097076102 12:56395984-56396006 CTTTGGGAGGAGGTAGAGGCAGG + Intergenic
1097248360 12:57619163-57619185 CCTTGGGCGGAGAGAGAGGCTGG - Intronic
1097729921 12:63116649-63116671 CCTTGGGGCAAGTGAAAGGAGGG + Intergenic
1098440725 12:70514359-70514381 CTTTGGGAGGAGGTAAATGTTGG + Intergenic
1098562109 12:71886201-71886223 GCATGGAAGGAAGGAAAGGAAGG - Intronic
1099548750 12:84016544-84016566 TGTTGGGAGGAGGGTAATGAGGG + Intergenic
1100191399 12:92196715-92196737 CCTTGGGAGGGAGGTGAGGAAGG - Intergenic
1100384340 12:94091686-94091708 CCTGGGGTGGAGGGCCAGGAGGG + Intergenic
1100684398 12:96970899-96970921 CCTGGTGAAGAGGGAGAGGAAGG + Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1100991840 12:100259786-100259808 TCTGGGGAGGAGGGAATGAAAGG + Intronic
1101427450 12:104599687-104599709 CCTGGGGAGGAGGGAATCGCAGG - Intronic
1101549345 12:105747630-105747652 CCCTGGGAGGAAGGGGAGGAGGG + Intergenic
1101884137 12:108647308-108647330 CCTAGGGAGGGCGGAAAGGGAGG - Exonic
1102100016 12:110270907-110270929 CCTTGGGGGGTGAGGAAGGAGGG + Intergenic
1102462782 12:113110202-113110224 GCTGGGGAGGAGGGGGAGGAGGG + Intronic
1102811961 12:115832161-115832183 GGTTGGGAGGAGGGAGAGAAGGG - Intergenic
1102924022 12:116813203-116813225 CTTTGGGAGGAGGCCAAGGTGGG - Intronic
1102960110 12:117086987-117087009 CCTTGGGAGGGAGGCAGGGAGGG + Intronic
1103059615 12:117847954-117847976 ACGTGGGAGGGGGAAAAGGAGGG + Intronic
1103102367 12:118189756-118189778 GATGGGGAGGAGGGGAAGGAAGG + Intronic
1103345680 12:120248551-120248573 ACTGGGGAGGAGGGAAGAGAGGG - Intronic
1103899117 12:124294473-124294495 TCTTGGGAGGAAGGAAAAGAAGG + Intronic
1104043726 12:125146852-125146874 CTTTGGGAGGAGGCCAAGGCAGG + Intergenic
1104088197 12:125494212-125494234 TCCAGGGAGGAGGGAGAGGAGGG - Intronic
1104088375 12:125494742-125494764 TCCAGGGAGGAGGGAGAGGAGGG - Intronic
1104312000 12:127661837-127661859 CTCTGGGAGAAGGGAAGGGATGG - Intergenic
1104439768 12:128785266-128785288 CCTTATGAGAAGGGATAGGAAGG + Intergenic
1104570058 12:129917372-129917394 GTTTTGGAGGAGGAAAAGGAAGG - Intergenic
1105255524 13:18741936-18741958 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
1105627808 13:22130128-22130150 CCTTGTGAAGTGGGAAAGGCAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105994175 13:25654448-25654470 CTTTGGGAGGAGGCCAAGGCGGG - Intronic
1106266619 13:28116205-28116227 CTTTGGGAGGAGGCAGAGGTGGG - Intergenic
1106572443 13:30939202-30939224 GCCTGGGAGGAGGGATAGGAAGG + Intronic
1106719794 13:32426581-32426603 CCTTAGGAGGAGGGACAGCCTGG - Intronic
1106757672 13:32838995-32839017 CCTTGGGGGATGGGAAAGGTGGG + Intergenic
1106923457 13:34588916-34588938 CCTTGGGAGGAGGAGGAGAAGGG - Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1108054802 13:46474893-46474915 ATTTGGGAGGAGGTTAAGGAGGG + Intergenic
1108341616 13:49503243-49503265 CCTGGAGAGGAGGGAAAGGTGGG - Intronic
1108490208 13:50974405-50974427 CGTAGGGAGGAAGGAAGGGAGGG + Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1110527455 13:76555411-76555433 CCCTAAGAGGAGGGAAAGGGAGG - Intergenic
1111109742 13:83691560-83691582 TCTTGGGAGGAGGGAAAAAAGGG + Intergenic
1111958136 13:94780561-94780583 CTTTGGGAGGAGGCCAAGGTGGG - Intergenic
1112326125 13:98443840-98443862 GACTGGGAGGAGGGAAGGGACGG + Intronic
1112513040 13:100026902-100026924 GCTTAGGAGGAGGAAGAGGAGGG - Intergenic
1112912162 13:104500382-104500404 CGCTGGAAGGATGGAAAGGAAGG + Intergenic
1113193818 13:107782039-107782061 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1113294687 13:108946136-108946158 AATGGGGAGGAGGGAAGGGATGG - Intronic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1113618481 13:111697308-111697330 CTTTGGAGGGAGGGAGAGGAAGG - Intergenic
1114258536 14:21021974-21021996 ACTGGGGAGGAGGAAAGGGAGGG - Intronic
1114524163 14:23357730-23357752 CCTTGGGAAGAAAGAGAGGAAGG - Intronic
1114553288 14:23546612-23546634 CCTGGGGAGGAGGGATGGGCAGG + Intronic
1114773570 14:25455993-25456015 CCTGGGGAGGAAAGGAAGGAAGG - Intergenic
1115078241 14:29417026-29417048 GCATGGGAGGAGGGAGAAGATGG - Intergenic
1115585364 14:34806431-34806453 AGGTGGGAGGAGGGAGAGGATGG - Intronic
1115835130 14:37393846-37393868 ACTTGGGAGGAGGGGTGGGAGGG - Intronic
1115835975 14:37403046-37403068 CCTAGTGCGAAGGGAAAGGAGGG + Intronic
1116484228 14:45427644-45427666 CCATGGGACCAGGGAAAAGAGGG + Intergenic
1117978770 14:61321903-61321925 CCTCGGGAGGGAGGGAAGGAGGG + Exonic
1118283814 14:64452965-64452987 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
1118484047 14:66197089-66197111 CCATGGGTGGAGAGAAAGCAAGG + Intergenic
1118780524 14:69004826-69004848 AAGAGGGAGGAGGGAAAGGAAGG - Intergenic
1118919226 14:70134521-70134543 ACATGGGATGAGGAAAAGGAAGG - Intronic
1119054708 14:71407510-71407532 CCTGGGAGGGAGGGAAAGGAGGG - Intronic
1119091440 14:71785275-71785297 TTTTTGGAGGAGGGAAGGGAAGG + Intergenic
1119201445 14:72755830-72755852 CCTGTTGAGGAGGGCAAGGAAGG - Intronic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1120144054 14:80960123-80960145 CCTTGGTAGTATCGAAAGGATGG + Intronic
1120463275 14:84824396-84824418 CCTTGGGAGACAAGAAAGGAAGG - Intergenic
1120711267 14:87795775-87795797 CTTGGGGTGGGGGGAAAGGAAGG - Intergenic
1121114321 14:91332760-91332782 TCTCGGGAGGAGGGAAGGGGAGG - Intronic
1121306975 14:92912665-92912687 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1121447570 14:93988341-93988363 AGATGGGAGGAGGGAGAGGAGGG + Intergenic
1122275027 14:100586937-100586959 CCTGCGGCGGAAGGAAAGGAGGG - Intronic
1122293904 14:100694331-100694353 GATGGGGAGGAGGGAGAGGAAGG - Intergenic
1122329926 14:100905017-100905039 CCTATGAAGGACGGAAAGGAGGG + Intergenic
1122418935 14:101563542-101563564 CCTTGGGAAGCGGGACGGGAAGG + Intergenic
1124213155 15:27780500-27780522 CCTTGGGAGTTGGGACAGGCAGG - Intronic
1124988752 15:34649929-34649951 CCTTGGGTGGGTGTAAAGGAAGG - Intergenic
1125121015 15:36158745-36158767 CCTGGGGAGGAGGGAGATGAGGG + Intergenic
1125297378 15:38217829-38217851 CTTTGGGAGTAGGGAGAGGTGGG - Intergenic
1125550155 15:40538983-40539005 CCATGGGAAGAGGGACAGGCTGG - Intronic
1125646812 15:41279471-41279493 CTTTGGGAGAAGGGGAATGAGGG - Exonic
1125686144 15:41564505-41564527 CCTTGGGAGGGAGGGAAGGAGGG + Intronic
1126388337 15:48117892-48117914 CTTTGGGAGTTGGGAAAGGGTGG - Intergenic
1127245496 15:57168797-57168819 CTTTGGGAGGAGGCCAAGGCGGG + Intronic
1127285230 15:57526877-57526899 CATTGGGAAGGGGGACAGGAAGG + Intronic
1128702980 15:69817503-69817525 CCATGGAAGGAAGGAAGGGAGGG + Intergenic
1129322052 15:74780906-74780928 CGTAGGGAGGAGGTAAAGGTGGG - Intergenic
1129779459 15:78260544-78260566 CCTGGGGAGGGGGGTCAGGAAGG - Intergenic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1130127096 15:81103336-81103358 CCTTGGGGCAAGTGAAAGGAGGG - Intronic
1130538354 15:84802826-84802848 CCTGAGAAGGAGGGAAATGAGGG + Exonic
1131069515 15:89457009-89457031 CCATTGTAGGAGGGATAGGAAGG - Intergenic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132668841 16:1094617-1094639 GCTTGGGAGGAGGGGCGGGAGGG - Intronic
1133102222 16:3486400-3486422 CCTGAGGAGGAGGGAGAGGGAGG + Exonic
1133765064 16:8832215-8832237 CCTTGGCGGGAGAGAAAGGAAGG + Intronic
1134072366 16:11268784-11268806 CCTTGGGGGCAGTGAGAGGAAGG - Intronic
1134420883 16:14088039-14088061 CTTTGGGAGGTGGAAATGGATGG + Intronic
1134629268 16:15745237-15745259 CCTAGGGAGGGGGGAAGAGAAGG + Exonic
1134854473 16:17506820-17506842 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1135066606 16:19315091-19315113 AAAGGGGAGGAGGGAAAGGAGGG + Intronic
1135206024 16:20484591-20484613 CCCTGGGGGAAGGGAGAGGAAGG + Intronic
1135212888 16:20539193-20539215 CCCTGGGGGAAGGGAGAGGAAGG - Intronic
1136027759 16:27480928-27480950 CCATGAGAGGAGAGACAGGAGGG + Intronic
1136137478 16:28265474-28265496 ACTTGGGAGGAGGCTAAGGCAGG + Intergenic
1136346188 16:29677659-29677681 CCTTGGAAAGAGGGAAGGGAAGG + Intronic
1136371843 16:29841574-29841596 CCTTGGGACGAGGACAGGGAGGG - Exonic
1136381343 16:29897273-29897295 CCTTGGGAGGAGGTAGGGGCTGG - Intronic
1136925178 16:34365483-34365505 GCTTGGGAGTAGGGCATGGAGGG + Intergenic
1136979395 16:35046323-35046345 GCTTGGGAGTAGGGCATGGAGGG - Intergenic
1136987625 16:35125322-35125344 CCATGGGAAGAGGCAGAGGAAGG - Intergenic
1137001704 16:35235091-35235113 CCTTGGGAGGTGGGGAAGATGGG - Intergenic
1137465101 16:48700490-48700512 CCTTGGGAAAAGGGTAGGGAGGG + Intergenic
1137893114 16:52183032-52183054 CCTAGTCAGCAGGGAAAGGAAGG + Intergenic
1137943055 16:52707842-52707864 ACTTGGGGGGAGGGGAAGGAAGG - Intergenic
1138104481 16:54280399-54280421 CCCTGAGAGGAGGGAGATGAGGG + Intergenic
1138229346 16:55325998-55326020 TCCTGGGAGGAGGGTAGGGAAGG + Intronic
1139834606 16:69828217-69828239 CCTTAGGAGGAGGGAAAGAAAGG - Intronic
1140107139 16:71971133-71971155 CCTTTGGTGGAAGGGAAGGAAGG + Intronic
1140343072 16:74184464-74184486 CCTGGGGAGGAGGCAGAGGCAGG + Intergenic
1140466361 16:75186177-75186199 TCTTGGGAGGAGGAAAGGGTAGG + Intergenic
1141010328 16:80391071-80391093 CCTTGGGAGGAAGGTGAGCAGGG - Intergenic
1141271022 16:82541339-82541361 TCTTAGCTGGAGGGAAAGGAGGG + Intergenic
1141288412 16:82694549-82694571 GCCTGGGAGGAAGGGAAGGAGGG - Intronic
1141870870 16:86784622-86784644 CCTTCGGAGGAAGGTAAGGGAGG - Intergenic
1141945325 16:87305459-87305481 ACTTGGGAAGAGGGAAGGGGTGG + Intronic
1142137778 16:88459609-88459631 GCTGGGGAGGAGGGAGAGGAGGG - Intronic
1142164323 16:88577610-88577632 CCCAGGGAGGAGGGGAAGGCTGG + Exonic
1142475013 17:183505-183527 ACTGAGGAGGAGGGGAAGGAGGG + Intergenic
1143633622 17:8152193-8152215 CCTTGGGGGCAGGGAGAGGGTGG + Intronic
1143697205 17:8629983-8630005 CCGTGGGTGGAGGGACAGGAGGG - Intronic
1144113507 17:12062920-12062942 TAAGGGGAGGAGGGAAAGGAGGG - Intronic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1144620453 17:16815407-16815429 GCTTGGGAGAAGGGAAGAGATGG - Intergenic
1144889210 17:18484457-18484479 CCTTGGGAGGGAGGAAGGGGTGG - Intronic
1145000929 17:19304194-19304216 CCCTGCGAGGAGGTAAAGTAAGG + Intronic
1145142998 17:20459839-20459861 CCTTGGGAGGGAGGAAGGGGTGG + Intronic
1145394296 17:22482508-22482530 GCTGGGGAGGAGGGAGAAGAGGG + Intergenic
1145721994 17:27082346-27082368 CCATGGAGGGTGGGAAAGGAAGG + Intergenic
1146181902 17:30703807-30703829 CCCTGGAAGGATGGAGAGGATGG - Intergenic
1146410749 17:32582017-32582039 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
1146553345 17:33801198-33801220 TCTTGGGAGAAAGGAGAGGAAGG + Intronic
1146623809 17:34420874-34420896 TTTGGGGAGGAGGGAAGGGAAGG - Intergenic
1146773826 17:35594484-35594506 CCTTGGGAATAGGAACAGGAAGG - Intronic
1146891296 17:36508083-36508105 CCTTGGGTGGAGGGTGGGGAAGG - Intronic
1147135986 17:38434461-38434483 CCCTGGGAGGAGAGACAGCATGG + Intronic
1147136076 17:38434840-38434862 TCTTGGGAGGAGGGAGAGGTGGG + Intronic
1147255115 17:39176733-39176755 CCATGGGAGGAGGGCAAGGCAGG + Intronic
1147385282 17:40077487-40077509 CCCTGGGAGGAAGGAAAGGATGG - Exonic
1147565731 17:41535488-41535510 CCATGGCAGGAGGGGAGGGAAGG + Intergenic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1148051767 17:44773102-44773124 CATGAGGAGGAGGGAAGGGAGGG - Intronic
1148551496 17:48553039-48553061 ACTTGGAAGGAGGCAAAGGCTGG - Exonic
1148571213 17:48670811-48670833 CTTTGGGAGGAGGCCAAGGTGGG - Intergenic
1148712709 17:49693388-49693410 CTGTGGAAGGAAGGAAAGGAGGG - Intergenic
1148734215 17:49855665-49855687 GATTGGGAGGAGGAAGAGGAAGG + Intergenic
1149126890 17:53245541-53245563 CCTTGACAGGACGGAAAGAAGGG - Intergenic
1149387520 17:56156622-56156644 ACGTGGGAGGTGGAAAAGGAAGG + Intronic
1149391388 17:56194932-56194954 GATAGGAAGGAGGGAAAGGATGG - Intronic
1149599266 17:57882667-57882689 GCTGAGGAGGAGGGACAGGAGGG - Intronic
1149623080 17:58060618-58060640 CCTGGTGAGGAGGAAAAGGTGGG - Intergenic
1150439467 17:65179526-65179548 CCTGGGGAGGAGAGAGAGGGTGG + Intronic
1151331347 17:73411059-73411081 CCCTGGGGGGAGGCAGAGGAAGG - Intronic
1151630838 17:75309722-75309744 CCTGGGGTGGAGGGAAAGGCAGG - Intergenic
1151654625 17:75490169-75490191 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1151732100 17:75917690-75917712 CCGTGGCAGGAGGGGCAGGAGGG + Intronic
1152275138 17:79352095-79352117 CCTTGAAAGGAGGAAAAGGCAGG - Intronic
1152280378 17:79381786-79381808 CATTTGGAGATGGGAAAGGAAGG - Intronic
1152307864 17:79531636-79531658 CCTTGGGAGGCGGCCAAGGCTGG - Intergenic
1152401611 17:80069946-80069968 CCTAGGGAGGGAGGACAGGATGG + Intronic
1152605131 17:81285756-81285778 CCGTGGGAGGAAGGAAACCAGGG - Intronic
1152769467 17:82158237-82158259 CCCTGGGAGGAGGCTCAGGAAGG - Intronic
1153299593 18:3581192-3581214 CCTGAGAAGGAGGGAAATGAGGG + Intronic
1153954089 18:10081321-10081343 CCTAGGGATGAGGCACAGGAGGG + Intergenic
1153957837 18:10113291-10113313 CAGTGAGAGAAGGGAAAGGAGGG - Intergenic
1154306590 18:13234856-13234878 ATTTGGGAGGAGAGAATGGAAGG - Intronic
1154435496 18:14338668-14338690 GAATGGGAGGAGGGAAAGGAAGG - Intergenic
1154493147 18:14936525-14936547 CCTAGGGCGGAGGGTAGGGAGGG + Intergenic
1155783765 18:29873592-29873614 CCTTTAGAGAAGGGAAAGGTAGG + Intergenic
1155834053 18:30556303-30556325 CCTTGGAAGGAGGCCAAGGTGGG + Intergenic
1155956280 18:31959515-31959537 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1156700487 18:39819047-39819069 CTTTGAGAGAATGGAAAGGAGGG + Intergenic
1156813702 18:41282604-41282626 CCTTGGGATAAGTAAAAGGAGGG + Intergenic
1157451510 18:47792620-47792642 CCTGGGGAGAAGGGGAATGATGG - Intergenic
1157499536 18:48179981-48180003 CCTTGTAAGGAAGGAAGGGAGGG - Intronic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1158090106 18:53700987-53701009 ACTGGGAAGGAAGGAAAGGAAGG + Intergenic
1158324600 18:56300544-56300566 CCTTGGGGGGATGGAAAACACGG + Intergenic
1159122788 18:64190261-64190283 TCATGGCAGGAGGCAAAGGAGGG + Intergenic
1160011518 18:75110057-75110079 CCAGGGGAGGAGGGAGAGGGAGG + Intergenic
1160429854 18:78803925-78803947 CCTTTGGTGGAGGGAGAGGCTGG - Intergenic
1160563496 18:79772934-79772956 CCTCAGGAGCAGGGAAAGAAGGG - Intergenic
1160910401 19:1471338-1471360 CCTCGGGTGGAGGGCAAGGCTGG - Exonic
1160944537 19:1635246-1635268 CTTTGGGAGGAGGGAAGGTGAGG - Intronic
1161265929 19:3364597-3364619 TCTTGGGAGGTGGGGAAGGTTGG - Intronic
1161415753 19:4145511-4145533 GCTGAGGAGGAGGGAGAGGAGGG + Intergenic
1161502251 19:4622811-4622833 CCTTGGGCAGAGGGGAGGGAAGG + Intergenic
1161795118 19:6381850-6381872 CCTGGGAAGGGAGGAAAGGAAGG + Exonic
1161898435 19:7099674-7099696 TCTTGGGAGCAGGGGAAGGGAGG + Intergenic
1161940550 19:7400723-7400745 ACTTGGGAGGCTGGAATGGAAGG + Intronic
1162146107 19:8612849-8612871 CCTTAAGAGGAGGGACAGGTGGG - Intergenic
1162433668 19:10644027-10644049 GCTGGGAAGGAGGGAAAGGGAGG + Exonic
1162474930 19:10894156-10894178 CGCTGAGAGGAGGGAAAGCACGG - Intronic
1162976936 19:14211984-14212006 CCCTGGAAGGATGGAGAGGATGG + Intergenic
1163023278 19:14495225-14495247 TCTGGGGAGAAGGGAAAGGAGGG + Intronic
1163137284 19:15321389-15321411 ACTTGGGTTGAGGGAATGGAGGG + Intronic
1163770725 19:19189527-19189549 CCAGGGGTGGAGGGCAAGGAAGG - Intronic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165266678 19:34667266-34667288 TCTGGGAAGGAGGGATAGGATGG - Intronic
1165411571 19:35665640-35665662 CGGTGGGCTGAGGGAAAGGATGG - Intergenic
1165948413 19:39458879-39458901 CCTCTGGAGGTGGGCAAGGAAGG + Exonic
1166082365 19:40452063-40452085 CCTTGGGAGGAGGGAAGGAGGGG - Intronic
1166103233 19:40583524-40583546 CCCTGGGAGAGGGGAAGGGAGGG + Intronic
1166521285 19:43481914-43481936 ATTAGGGAGGAGGGAAAGGAAGG + Intronic
1166525008 19:43505044-43505066 CCTTGGGAGTTCAGAAAGGAAGG + Intergenic
1166704889 19:44903254-44903276 CCAAGGGGGGAGGGAAGGGAGGG - Exonic
1166718657 19:44985191-44985213 GGTTGGGAGGTGGGAAAGGAGGG - Intronic
1166826970 19:45615889-45615911 CCTGCGGGGGAGGGAAGGGATGG + Exonic
1167232722 19:48295635-48295657 GCCTGGAAGGAGAGAAAGGAAGG - Intergenic
1167349007 19:48963467-48963489 CCATAGGTGGAGGGAGAGGAGGG - Intergenic
1167360216 19:49026041-49026063 ACTGGGGAGGAGGAAAATGAGGG + Intronic
1167362782 19:49039057-49039079 ACTGGGGAGGAGGAAAATGAGGG + Intergenic
1167463009 19:49636207-49636229 TGATGGGAGCAGGGAAAGGAGGG + Intronic
1167645378 19:50702729-50702751 CCTTGGGTGGGGGAAGAGGACGG + Intronic
1168468611 19:56623227-56623249 CGGTGGGTGGAGGGATAGGAAGG - Exonic
1168604891 19:57750703-57750725 CCTTGGGAGGAGGAAGGGCAAGG + Intronic
925185253 2:1842584-1842606 CCAAGGGAGGAAGGAAAGGTCGG - Intronic
925593736 2:5535097-5535119 GGTGGGGAGGAGGGAGAGGATGG + Intergenic
926147949 2:10408200-10408222 CCTTGAGAGGGTGGAAAAGAAGG + Intronic
926455139 2:13057955-13057977 CTATGGAAGGAAGGAAAGGAGGG - Intergenic
926715610 2:15921546-15921568 CCTTAGCAGGAGGGAAGGCAGGG - Intergenic
927095137 2:19742597-19742619 CCACGGGAAGAGGGAAGGGAGGG + Intergenic
927480665 2:23451528-23451550 CCTTGGGAAGAGGGAGATGCAGG - Intronic
927868956 2:26611302-26611324 CCGTGGGAGGATGGAGAGAATGG + Intronic
927879486 2:26680671-26680693 CCTTGGGAAGAGGGATAGAAAGG - Intergenic
928305851 2:30169866-30169888 CTTTGGGAGGAGGCCAAGGCTGG - Intergenic
929184103 2:39075202-39075224 CAGTGGGAGGTGGGAAAGAAGGG + Intronic
929481015 2:42308257-42308279 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
929557881 2:42936796-42936818 GGCTGGGAGGAGGGGAAGGAGGG + Intergenic
929815747 2:45229971-45229993 CCATAGGAATAGGGAAAGGAAGG - Intergenic
930026456 2:47032054-47032076 GCTTGGGAGGAAGGGAAGGGTGG - Intronic
930079557 2:47434536-47434558 CCGTGGGGAGAGGGAGAGGAGGG + Intronic
930199583 2:48540351-48540373 CCTTGGGGTAAGTGAAAGGAGGG - Intronic
930237335 2:48900620-48900642 CCATGGAAGGAGGGAGAGGCTGG + Intergenic
930711650 2:54556136-54556158 AGTGGGGAGGAGGTAAAGGAAGG - Intronic
930752350 2:54945719-54945741 CCTTGGGGAGGGGGAAAGGAGGG + Intronic
931116803 2:59174197-59174219 CCACAGGAGGAGGGAATGGAGGG + Intergenic
931241032 2:60452870-60452892 CCTTGGGGGGACGGAAGGGAGGG - Intronic
931258060 2:60591444-60591466 CTTTGGTAGGAGGGAAATGCTGG - Intergenic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
932029991 2:68173535-68173557 CCTTGGGAGTTGGCAAAGGTGGG + Intronic
932569166 2:72928885-72928907 CCTAGGTTGGAGGGAAAGAAGGG + Intronic
934555652 2:95285757-95285779 GCTTGGGAGGCGGGAAAGGGTGG + Intronic
934903755 2:98181359-98181381 CCTTTGGAGAAGGGTGAGGAGGG - Intronic
935441536 2:103103700-103103722 CCTGGGGAGGAGGGATAGGTAGG + Intergenic
935889201 2:107657646-107657668 CCCAGGGAGGAGGGAATGAATGG - Intergenic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
936931057 2:117789251-117789273 CATGGGCAGGAGGGACAGGATGG - Intergenic
937272635 2:120663094-120663116 CCTGGGGAGGTGGGCAATGATGG - Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937890784 2:126936993-126937015 CCTTGGGTGGAGGGAAGCAAAGG - Intergenic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
937991238 2:127663650-127663672 CCTGGGGAGGAGGCCAAGGCTGG - Intronic
938113664 2:128589076-128589098 CCTAGGCAGAAGGGAGAGGAGGG - Intergenic
938278446 2:130048629-130048651 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
938329421 2:130439488-130439510 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
938360527 2:130682015-130682037 GAATGGGAGGAGGGAAAGGAAGG - Intergenic
938436930 2:131288723-131288745 GAATGGGAGGAGGGAAAGGAAGG - Intronic
938673268 2:133604974-133604996 GCATGGGAAGAGGGAAGGGAAGG - Intergenic
938786660 2:134636050-134636072 CCATGGGGGAAGGGAAAGGAAGG - Intronic
938826779 2:135013585-135013607 CCAAGGGATGAGGGGAAGGAAGG - Intronic
939314341 2:140528534-140528556 CTTTGGGAGGGGGACAAGGATGG + Intronic
940778581 2:157909712-157909734 TCTTAAGAGGAAGGAAAGGAAGG + Intronic
941789332 2:169534303-169534325 CCATGGCAGAAGGGACAGGAAGG - Intronic
942777582 2:179602440-179602462 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
943246649 2:185461758-185461780 CCTTGGTAGCAGGGAAAGCTGGG + Intergenic
943645249 2:190403146-190403168 CCTTGCGGGGAGGAAATGGAAGG - Intergenic
945035769 2:205702838-205702860 CTGTGGAGGGAGGGAAAGGAGGG - Intronic
945039518 2:205732371-205732393 ACTTGGGAGGAGAGAAAGAGTGG + Intronic
945881655 2:215330657-215330679 GTTGGGGAGAAGGGAAAGGAGGG - Intronic
946406183 2:219493159-219493181 GCTGGAGAGGAGGAAAAGGAAGG + Exonic
946687860 2:222290046-222290068 GGTTGGGAGGAGGGGAAGGCGGG - Intronic
947363903 2:229374236-229374258 ACTAGGGAGTAAGGAAAGGAAGG + Intronic
947561397 2:231156503-231156525 ACTTGTGGGGAGGGCAAGGAGGG - Intronic
948815886 2:240510186-240510208 ACTAGGGAGGAGGGCAGGGAGGG - Intronic
1168844990 20:938261-938283 CATGGGGATGAGTGAAAGGAAGG + Intergenic
1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG + Intergenic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1170006828 20:11678459-11678481 CCTTGAGTGGAGGTGAAGGAGGG - Intergenic
1170230176 20:14037770-14037792 CCTTGGGAGGAGGCTGAGGCGGG + Intronic
1170839099 20:19909298-19909320 CCTTGGGGGTAGGGCAGGGAAGG - Intronic
1171192805 20:23171341-23171363 ACTTGGGGGGAAGGGAAGGAGGG - Intergenic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1171316348 20:24199157-24199179 TCCTGGGAGAAGGGAATGGAAGG + Intergenic
1171385785 20:24768639-24768661 CTTTGGGAAGAGAGAAAGAAGGG - Intergenic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1172104916 20:32511080-32511102 TCGTGGGAGGAGGGGGAGGAGGG - Intronic
1172208634 20:33182078-33182100 CCTTGGGTGGAGGGAGAAGCTGG - Intergenic
1172278588 20:33694667-33694689 GCTTGGGAGGAGAGAATGGGAGG - Intergenic
1172477221 20:35248075-35248097 CCTAAGGAGGTGGGAAGGGAGGG + Intronic
1172618231 20:36303994-36304016 TATGGGGAGGAGGGGAAGGAAGG - Intergenic
1172821008 20:37734393-37734415 GCTGGTGAGGAGGGAAGGGAGGG - Intronic
1172927532 20:38552385-38552407 CTTTGAGGGGAGGCAAAGGAGGG - Intronic
1172935355 20:38616187-38616209 CTTGGGGTGAAGGGAAAGGAGGG - Intronic
1173227914 20:41172657-41172679 CCCTGTGAGGAGGGTGAGGAGGG + Intronic
1173348429 20:42222464-42222486 CCTTGGGGCAAGTGAAAGGAAGG - Intronic
1173614521 20:44394154-44394176 CCCTGGGAGGAGGGGGAGAACGG + Intronic
1173658187 20:44715428-44715450 CTTTGAGAGGAGGCAGAGGAGGG - Exonic
1173749290 20:45464084-45464106 CCTTCCTAGGATGGAAAGGATGG - Intergenic
1173868441 20:46327651-46327673 CCTGGGGTGGAGGAGAAGGAAGG + Intergenic
1174055880 20:47798108-47798130 CTTTGGGAGGAGGCCAAGGCCGG + Intergenic
1175163246 20:57024230-57024252 CCATGAGAGGAGGGAAAGTGTGG + Intergenic
1175297139 20:57916189-57916211 CCCTGGGAGGAGGGACAGTGTGG + Intergenic
1175389957 20:58620758-58620780 CCTTCGGTGGTGGGAAGGGATGG + Intergenic
1175737977 20:61400330-61400352 CACTGGAAGGAAGGAAAGGAAGG + Intronic
1175962338 20:62643283-62643305 ACCAGGGAGGATGGAAAGGAAGG + Exonic
1176198249 20:63847838-63847860 AGTGGGGAGCAGGGAAAGGAAGG - Intergenic
1176841536 21:13846965-13846987 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
1177586421 21:23101901-23101923 CTTTGGGAGGTGGAAAAGGGCGG + Intergenic
1177673846 21:24270961-24270983 CCTTGAGAGTAGACAAAGGAGGG - Intergenic
1177714485 21:24821678-24821700 TCTTGAGAGGAGGGTAAGTAAGG + Intergenic
1178574361 21:33771768-33771790 CATGGGAAGAAGGGAAAGGATGG + Intronic
1178600127 21:33987583-33987605 CCTTGGCAGGCAGGACAGGATGG + Intergenic
1179005592 21:37511329-37511351 CCTTTGGAGAAGGGCAAGGATGG + Intronic
1179062495 21:37992000-37992022 CGATGGGAGAAGGGAGAGGATGG - Intronic
1179416021 21:41199342-41199364 CCCAGGGAGGAGGGGAAGGCTGG + Intronic
1179520002 21:41936691-41936713 GCTGAGGAGGAGGGAGAGGAGGG - Intronic
1179708496 21:43195894-43195916 CGGTGGGAGGTGGGGAAGGAAGG + Intergenic
1179768514 21:43594705-43594727 CGGTGGGAGGAAGGGAAGGAGGG + Intronic
1180140714 21:45892084-45892106 CCTCGGGAGTAGGGAGGGGAAGG + Intronic
1180211387 21:46297264-46297286 GCATGGGAGGTGGGAAGGGAAGG - Intronic
1180241258 21:46508140-46508162 CCTTGGGAGGCTGAGAAGGAAGG - Intronic
1180928329 22:19571441-19571463 CCCTTGGAGGAGGGACAGGGAGG + Intergenic
1180951574 22:19722875-19722897 CCGCGGGAGCAGGCAAAGGAGGG - Exonic
1181056268 22:20261850-20261872 CCTGGTGAGGATGGAAAAGAAGG + Intronic
1181097857 22:20518301-20518323 CCTTGCAGGGATGGAAAGGATGG - Intronic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181628582 22:24137980-24138002 CCTTGAGAGGAGATAAAGGGAGG + Intronic
1181919673 22:26310883-26310905 GCCTGGGAGCAGGGAAAGCATGG + Intronic
1182586407 22:31346376-31346398 CCCTGGGGGGAGGAGAAGGAGGG + Intergenic
1183099066 22:35572460-35572482 ACAGGGGAGGAGGGAAAGAAAGG - Intergenic
1183310649 22:37107766-37107788 CCTTTGGAGGAGGTAAAGGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183474046 22:38026252-38026274 CCTGGGCAGGAGGGAAAGAGAGG - Intronic
1183600495 22:38837379-38837401 GCTTGGGAGAAGGGAATGGCGGG - Intronic
1183646325 22:39129076-39129098 CCAGGGGAGGAGGGAAAGCCAGG - Intronic
1184130537 22:42514362-42514384 CTTTGGGAGGAGGGCGTGGAGGG - Intronic
1184140716 22:42576192-42576214 CTTTGGGAGGAGGGCGTGGAGGG - Intergenic
1184455007 22:44605078-44605100 CCTGGGGAGGAGGGGCATGAGGG + Intergenic
1184459826 22:44630846-44630868 CCTGGGGAGGAGGGATGGGTGGG + Intergenic
1184643165 22:45882865-45882887 CCTAGGGAGGAGGGCAGGGATGG + Intergenic
1184817102 22:46880763-46880785 CCATGGCAGGTGGGGAAGGAGGG + Intronic
1184825529 22:46948069-46948091 CCTTTGGAGGGCGGCAAGGACGG + Intronic
1185134532 22:49062259-49062281 CCAGGGGAGGAGGGGAAGGTGGG - Intergenic
1185179395 22:49350348-49350370 CCCAGGGAGGAGGGAGAGGTGGG + Intergenic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949818496 3:8089216-8089238 CTTAGAGAGGAGGAAAAGGACGG + Intergenic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
949991673 3:9584343-9584365 CTTTGGGAGGAGGCCAAGGCGGG + Intergenic
950096751 3:10335121-10335143 GCTTGGCAGGAGGGAGATGAAGG + Intronic
950181686 3:10917981-10918003 CCCTGGTAGGAGAGAAAGGCTGG - Intronic
950187037 3:10951688-10951710 GATGGGGAGGAGGGAGAGGAGGG - Intergenic
950313463 3:11979275-11979297 CTTTGGGAGGAGGGCGAGGCGGG + Intergenic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950582741 3:13873206-13873228 GCTTGGGAAGAGGGAAAAGCAGG + Intronic
952026893 3:29093511-29093533 AAGTGGGAGGAGGGAAAGGTGGG - Intergenic
952239064 3:31511214-31511236 CCTTTGCAAGAGGGAAAGCAGGG - Intergenic
952305433 3:32141940-32141962 ACTAGAGAGGAGAGAAAGGAGGG - Intronic
952389939 3:32871354-32871376 TCTTGAGAAGAGGGAAAGAACGG + Intronic
952882058 3:37991376-37991398 CCTGGGGAGGAGGGTGGGGAGGG + Intronic
953063656 3:39449505-39449527 CCTTGGGAGGCGGAGGAGGATGG - Intergenic
953230564 3:41061530-41061552 GGGTGGGAGGAGGGAGAGGATGG - Intergenic
953910307 3:46889451-46889473 CCTTGGAAGAAGGGAAAGAGAGG - Intronic
954048178 3:47951335-47951357 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
954175085 3:48838271-48838293 CCTAGGGATGAGGGGAATGAGGG + Intronic
954551226 3:51483190-51483212 CTTTGGGAGGAGGCCAAGGCGGG + Intronic
954640357 3:52094082-52094104 CCTGTGGGGGAGGGAAGGGATGG + Intronic
954966064 3:54612109-54612131 CCTTGGGAAGAGGAAGAGGAAGG + Intronic
955893011 3:63670172-63670194 CCATGGAAGAAGGGAAAGGAAGG + Intronic
956021199 3:64934952-64934974 CCTTGTCTGGAGGCAAAGGATGG + Intergenic
956061728 3:65355255-65355277 GGTTGGTAGAAGGGAAAGGAAGG - Intronic
957297532 3:78352331-78352353 TCATGGGAGCAGGGAAAGGTGGG - Intergenic
957640867 3:82851524-82851546 CCTTGAAAGGAAGAAAAGGAGGG + Intergenic
959201882 3:103255911-103255933 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
959391243 3:105776977-105776999 CCTGGAGAGGAGAGAAAGGGAGG + Intronic
959633946 3:108540387-108540409 CTCTGGGAGGAAGGAAAGTATGG + Intergenic
960288990 3:115861201-115861223 TGTAGGGAGGAAGGAAAGGAAGG - Intronic
960641792 3:119831917-119831939 CTTTGTGGGGAAGGAAAGGAAGG + Intronic
961236755 3:125374638-125374660 CTTTGGGAGAAGGGAAGGGCAGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961250584 3:125501371-125501393 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
962071156 3:132034918-132034940 GCGAGGGAGGAAGGAAAGGAGGG + Exonic
962250393 3:133832712-133832734 CCTGGGCAGAAGTGAAAGGATGG + Intronic
962318869 3:134374940-134374962 CCGGGGGAGGTGGGAAAGGGAGG + Intronic
962571996 3:136722677-136722699 CCGTGGGGAGAGGGAAAGGGGGG - Intronic
963087907 3:141455591-141455613 CCTGTGGAGGAGGGCAAGCACGG - Intergenic
963476529 3:145812134-145812156 CTTTGGGAGGAGGCCAAGGTGGG + Intergenic
964392892 3:156215738-156215760 CCTGGGGAGGAAGAAAGGGAAGG + Intronic
964447140 3:156771363-156771385 CCATGGGAGGAGAGAAAAGCAGG - Intergenic
965455342 3:168892826-168892848 CATTGGGAGCAGGTAAAGGAAGG + Intergenic
966441999 3:179955862-179955884 CTTTGGGAGGGGGTAAAGTATGG - Intronic
966915551 3:184582419-184582441 CTTTGGGAGGAGGAATAAGAAGG - Intronic
967142104 3:186570074-186570096 ACTTGGGAGGAGGGGAGGGGTGG + Intronic
969054306 4:4392154-4392176 CATTGGGATGGGGGGAAGGATGG - Intronic
969253935 4:5990101-5990123 CCTGAGCAGGAGGGAAAGGGTGG - Intergenic
969392623 4:6901497-6901519 GTTTGGGAGGAGGTACAGGAAGG + Intergenic
969513275 4:7631780-7631802 CCCTGTGAAGAGGGAAGGGAGGG - Intronic
969849757 4:9947071-9947093 CCTGGGGAAGAGGGGTAGGAAGG - Intronic
969867397 4:10084754-10084776 CCTTGGAGGGAGGGGAATGAAGG - Intronic
971228952 4:24782104-24782126 CCTTAGGAGGAAGAGAAGGATGG - Intergenic
971861581 4:32112750-32112772 TCTTTGGAGGAGGAGAAGGAAGG + Intergenic
973256243 4:48116550-48116572 CCAAGTGAGGAGGGAAGGGAAGG + Intronic
973782982 4:54307021-54307043 ACTTGGGAGGAGGCATGGGAGGG + Intergenic
974043435 4:56877600-56877622 CCTGGGGAAGGGGGATAGGAAGG - Intergenic
974095203 4:57356051-57356073 CTGTGGGAGGAAGGAAAGGAGGG - Intergenic
974624438 4:64403785-64403807 CATGGGGAGGAGGAAAAGGGGGG + Intronic
975502856 4:75106395-75106417 TGTGGGGAGGGGGGAAAGGAAGG - Intergenic
975616143 4:76249690-76249712 ACTTGGGGGGAAGGATAGGACGG - Intronic
975715732 4:77204007-77204029 CCTTGTGTGGAAGGAATGGAGGG - Intronic
975993115 4:80281262-80281284 CCATTGGTGGAGGGAAGGGATGG + Intronic
976623325 4:87151561-87151583 CCTAGGGTGAAGAGAAAGGAGGG + Intergenic
977521213 4:98086808-98086830 CCTGAGGAGCAGGGAAAGAATGG - Intronic
977586286 4:98779021-98779043 CCATGGAAGGAGGGCAAGGTAGG + Intergenic
978059250 4:104316048-104316070 GTTTGGGAGGAGGGAGAGAAAGG + Intergenic
978238861 4:106492026-106492048 CCCAGGGAGGAGGAACAGGATGG + Intergenic
978331714 4:107620648-107620670 CCTGGGGAGGGGGAAGAGGATGG - Intronic
978376733 4:108081823-108081845 GATTGGGTGGAGGGTAAGGAAGG - Intronic
978405128 4:108371111-108371133 CCTAGGGAGGAGGGAGAGGGAGG - Intergenic
979615272 4:122735132-122735154 CGTTGGGAGCACAGAAAGGAGGG + Intronic
980954032 4:139410181-139410203 TCTAGGGAGAGGGGAAAGGATGG + Intronic
981103964 4:140859317-140859339 CCTGGGAAGGTGGAAAAGGAAGG - Intergenic
981128456 4:141132851-141132873 GCTGGGGAGGAGGGACGGGACGG - Intronic
981242077 4:142490023-142490045 TTTTTGGAGGGGGGAAAGGAGGG + Intronic
981429730 4:144645669-144645691 CCGTAGGAGGTGGGAAGGGAGGG - Intergenic
981680162 4:147388517-147388539 TCATGGCAGGAGGGAAAGCAAGG + Intergenic
981762567 4:148210046-148210068 CCAGGAGAGGAGGGAATGGAAGG - Intronic
981766067 4:148251320-148251342 CCTTGGCAGGATGGGAAGGATGG - Intronic
981912290 4:149995516-149995538 GGGTGGGAGGAAGGAAAGGAAGG + Intergenic
981917090 4:150046375-150046397 ACTTGGGAGAAGGGTATGGAGGG - Intergenic
982202316 4:152972961-152972983 GCTTGGAAGAAGGGAAAGGGAGG - Intronic
982897155 4:160945893-160945915 TCTTGAGAGAAGGGAAAAGATGG - Intergenic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
983601458 4:169534271-169534293 CCTTGAGAGAAGGGAAACAAAGG + Intronic
983609481 4:169626594-169626616 CCTTGGGTTGGTGGAAAGGAGGG + Intronic
986262017 5:6155863-6155885 GGTTGGTAGGAGGGAAATGATGG - Intergenic
986428104 5:7654694-7654716 GCATGGGTGGAGGGCAAGGAAGG - Intronic
987476299 5:18395861-18395883 CCTTGGGGGGAGGACAAGAAAGG - Intergenic
987985936 5:25145749-25145771 CCATGGCAGAAGGGCAAGGATGG - Intergenic
988224710 5:28398286-28398308 ACTTGGGAGGAGGGAGACCAGGG + Intergenic
988818373 5:34856492-34856514 ACTTGGGAGGAGAGAAGGAAAGG + Intronic
989435322 5:41406202-41406224 CTTTGGGTGAAGGGAAATGAAGG - Intronic
990259737 5:54009301-54009323 TGTTGGGTGGAGGAAAAGGAGGG - Intronic
990631445 5:57674688-57674710 CCTGGGAAGGAAGGAAGGGAGGG - Intergenic
991149873 5:63355331-63355353 CCTGGGGTTGAGGGAAGGGAGGG - Intergenic
991560024 5:67940873-67940895 CCTGTGGAGGAAGGAAAGGAGGG + Intergenic
991924370 5:71689895-71689917 ACTTGGGAGGAAAGAAGGGAAGG + Intergenic
992058745 5:73020589-73020611 CTTTGGGAGAAGGGGAATGATGG + Intronic
993853064 5:93035403-93035425 CTTGAGGAGGAGGGAAAGGGAGG - Intergenic
995106196 5:108380886-108380908 CCTTCGGAGGTGGGAGAAGAGGG + Exonic
995731058 5:115242718-115242740 CTTGGGGAGGAGGCAGAGGAGGG + Intronic
995856814 5:116601168-116601190 CCCTCAGAGGAGGGAGAGGAGGG - Intergenic
997016577 5:129942149-129942171 CCTTGGGATAGGTGAAAGGAGGG + Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998199604 5:140108602-140108624 CCCTGGAAGGAGGGAGAGGAAGG + Intronic
998372167 5:141668919-141668941 CATTGTCAGGAGGGAAAGGAAGG + Intronic
998850003 5:146343308-146343330 ACTCAGGAGGAGGGAAAGGGTGG - Intergenic
999135111 5:149313546-149313568 CCTTGAGAGGAGGGGCAGCATGG - Intronic
999270647 5:150294703-150294725 GCTTGTGGGGAGGGAAGGGAGGG - Intergenic
999275955 5:150330430-150330452 CCTGGGGAGGAGGGAAAAAAAGG - Intronic
999419085 5:151425397-151425419 CCTAGGGAGGAAGAGAAGGAAGG + Intergenic
999499980 5:152137121-152137143 GTTTTGGAGGAGGGAAAGGAAGG + Intergenic
999503812 5:152174556-152174578 ACTTTGGAGGATGGACAGGAGGG - Intergenic
999707642 5:154288339-154288361 CCTTTGGAGGTAGGAAAGAATGG - Intronic
999741814 5:154561337-154561359 CTTTGGGAGGAGGCCAAGGCGGG + Intergenic
999869180 5:155731357-155731379 GATGGGGAGGAGGGAAAGGGTGG + Intergenic
1000009289 5:157216620-157216642 CACTGTGGGGAGGGAAAGGAAGG + Intronic
1000244380 5:159437097-159437119 CCTGAGGAGCAGGGATAGGATGG + Intergenic
1000842443 5:166237855-166237877 CTTTGGGATCAGGGTAAGGATGG - Intergenic
1001045133 5:168365627-168365649 CCCTGAGAGGAGGGTAAGGGAGG + Intronic
1001260276 5:170222417-170222439 CCTTGGGATGGGGGAAGGGAGGG + Intergenic
1001264637 5:170264688-170264710 CCTTGGGAGGCTGGAGAAGAAGG + Intronic
1002094649 5:176823739-176823761 CGGTGGGAAAAGGGAAAGGACGG + Intronic
1002401981 5:178996018-178996040 CCTTGGATGGAGGGAGGGGAGGG + Intronic
1002566922 5:180117279-180117301 CCTTGGGTGGAGGGCCAAGAAGG + Intronic
1002587067 5:180255703-180255725 GCCTGGGAGGAGGGCGAGGAAGG + Intronic
1002980406 6:2130467-2130489 CCTTGAAAGGAGGGAAGGGGTGG - Intronic
1003106005 6:3216607-3216629 CGGTGGGAGATGGGAAAGGAGGG + Intergenic
1003146219 6:3512710-3512732 CCTTGGCTGGAGGGGAAGGCAGG + Intergenic
1004056773 6:12146993-12147015 GTTGGTGAGGAGGGAAAGGAAGG + Intronic
1004156766 6:13175954-13175976 CCAGGGCAGGAGGGAAAGGATGG + Intronic
1004343311 6:14826414-14826436 CCCAGAGAGGAGGAAAAGGATGG + Intergenic
1004454844 6:15782883-15782905 GCTGAGGAGGAGGGAGAGGATGG + Intergenic
1004598312 6:17122728-17122750 CGGGGGGAGGATGGAAAGGAAGG + Intronic
1004706129 6:18125403-18125425 CCCTGGGAGGAGGGCAAGGCTGG - Intergenic
1004793029 6:19050461-19050483 CCTAGGGAGGTGGGACAAGATGG + Intergenic
1005004068 6:21270497-21270519 ACTGGGGAGGAGAGAAAGGGAGG - Intergenic
1005090733 6:22054254-22054276 CTTTGGGAGGAGGCCAAGGCAGG - Intergenic
1005487887 6:26318545-26318567 CCTTGGCAAGAGAGAAAAGATGG + Intergenic
1005881476 6:30065362-30065384 GCTCAGGAGGAGGAAAAGGAGGG - Intergenic
1005995405 6:30927965-30927987 CAGAGGGAGGAGGGAAAGAAGGG + Intergenic
1006162852 6:32048171-32048193 CCTGGGGTGCAGGGAAAGTAGGG + Intronic
1006303610 6:33206879-33206901 CCTTCGGGAAAGGGAAAGGAGGG - Intergenic
1006409244 6:33862846-33862868 TCTTGGGAAGAGGGAAAAGACGG + Intergenic
1006453994 6:34121754-34121776 GAATGGGAGGAGGGACAGGAAGG + Intronic
1006744009 6:36329042-36329064 CCTTGGGAGGCAGAATAGGAAGG + Intronic
1006812364 6:36828120-36828142 CCTTGGCAGGTGCTAAAGGAGGG + Intronic
1006892439 6:37440634-37440656 CCTTGGGAGGAAGAGTAGGAGGG + Intronic
1006910687 6:37561613-37561635 CTCTGGGAGGAGGGACAGAAGGG + Intergenic
1006910963 6:37563397-37563419 CTCTGGGAGGAGGGACAGAAGGG - Intergenic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1007101529 6:39250894-39250916 AACTTGGAGGAGGGAAAGGAGGG - Intergenic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1007417517 6:41700697-41700719 GGTGGGGAGGAGGGAAAGGAAGG + Intronic
1007483093 6:42162899-42162921 TCCTGGGAGGGGGGAAAGAAGGG - Exonic
1008046229 6:46854203-46854225 TCTTGGGAGGAGGGCAGGTATGG - Intronic
1008393811 6:50983846-50983868 CCTTGGGAGGATGCAGTGGAAGG + Intergenic
1009194185 6:60664805-60664827 CCTGGGGAAGAGGCAGAGGAAGG + Intergenic
1009406044 6:63313988-63314010 CCCTGGGAGGACAGAAAAGATGG + Intronic
1010429366 6:75761307-75761329 GTATGGGAGGAGGGAAAAGAAGG + Intronic
1011531412 6:88326337-88326359 CCTGAGAAGGTGGGAAAGGATGG - Intergenic
1011704709 6:89989450-89989472 CCCAGGGAGGTGGGAAGGGAGGG + Intronic
1011937747 6:92801987-92802009 CCTGGGGCAGAGGTAAAGGATGG + Intergenic
1013042341 6:106448276-106448298 CCTTGAGAGGAGGAGAATGATGG - Intergenic
1013341959 6:109223757-109223779 CAGTGGGAAGAGGCAAAGGAAGG - Intergenic
1013441954 6:110179773-110179795 CCTGGGGCGGGGGGCAAGGATGG - Exonic
1013453729 6:110310872-110310894 TCCTGGCAGGAGGGAAAGAAGGG - Intronic
1013733576 6:113200158-113200180 CCCTGTGAGGAGAGAAAGCATGG - Intergenic
1014750710 6:125252905-125252927 CCTTGAGAGAAGAGAAAGCAGGG + Intronic
1015185333 6:130409107-130409129 CCTTGGAAGCAACGAAAGGAAGG - Intronic
1015381355 6:132573301-132573323 TTTTTGTAGGAGGGAAAGGATGG + Intergenic
1015537082 6:134277128-134277150 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
1016190145 6:141255211-141255233 TTGTGGGAGGAGGGAAAGCAAGG - Intergenic
1016372951 6:143393297-143393319 CCTGGAGAGGAGGAGAAGGAAGG + Intergenic
1016546732 6:145232473-145232495 GGGTGGGAGGAGGGAGAGGATGG - Intergenic
1017102757 6:150863228-150863250 CTTTGGGAGGAGGCCGAGGAGGG + Intergenic
1017170225 6:151449642-151449664 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1017569664 6:155731133-155731155 CCTTAGGAACAGGGGAAGGATGG + Intergenic
1018061623 6:160094083-160094105 CTTTGGGAGAAGGGGAATGATGG - Intronic
1018746240 6:166764452-166764474 CCTTGTGAGGAGGGAAGCGCGGG - Intronic
1019069122 6:169326956-169326978 CCTGTGGAGGTGGGAAAAGAGGG - Intergenic
1019280043 7:194999-195021 CCTTGGGTGGGGAGAGAGGAAGG - Intronic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1020246956 7:6436901-6436923 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
1020349709 7:7205496-7205518 CATTGGGTTGAGGAAAAGGAAGG + Intronic
1021205699 7:17777283-17777305 ACTTGGGAAGAGGGAAGGGAGGG - Intergenic
1021621063 7:22551432-22551454 CCTTGGGAGGCCTGAAAGGAAGG - Intronic
1021993639 7:26159291-26159313 ACTTGAGAGGAATGAAAGGAAGG - Intronic
1022355730 7:29612620-29612642 CCTTGGGAGGACAGCAAAGAGGG + Intergenic
1022466287 7:30655080-30655102 CCTGGAAAGGAGGGAAAGGAGGG + Exonic
1022922717 7:35032810-35032832 GCTTGGATTGAGGGAAAGGAAGG - Intronic
1023392275 7:39721609-39721631 CCTTGGGACAGGTGAAAGGAGGG + Intergenic
1023423749 7:40012350-40012372 CTTTGGGAGGAGGCCAAGGTGGG + Intronic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1024026187 7:45411910-45411932 CCTTGGGAGCTGGGAAGGGAGGG + Intergenic
1024028359 7:45433344-45433366 GCCAGGGAGGAGGGAGAGGAAGG - Intergenic
1024109258 7:46128767-46128789 CCATGGGAGGATGACAAGGAAGG + Intergenic
1024241251 7:47438359-47438381 ACTGGGGAAGAGGGGAAGGATGG + Intronic
1024256817 7:47545683-47545705 ACTGGGGAGGTGTGAAAGGACGG - Intronic
1024918070 7:54525727-54525749 TCCTGGGTCGAGGGAAAGGAGGG + Intergenic
1024921170 7:54556423-54556445 CATTGGGAGGAGGGAGATGAGGG + Intronic
1025237111 7:57242053-57242075 CTTTGGGAGGAGGCCAAGGCTGG - Intergenic
1027235421 7:76294946-76294968 CCTTGGGCGCAGGGAAAGGAAGG + Intergenic
1027298950 7:76809834-76809856 CCTGGAGAGGTGGGAGAGGAAGG - Intergenic
1027632218 7:80620708-80620730 CCTTGGGGCAAGTGAAAGGAGGG + Intronic
1027901853 7:84126447-84126469 CTTTGGGAGGCTGGAGAGGATGG - Intronic
1028405101 7:90466010-90466032 CCTAGGCAGGAGGAAGAGGAAGG - Intronic
1028494020 7:91444147-91444169 CCTTGGGAGAAAGAAAAAGATGG + Intergenic
1028587056 7:92462781-92462803 CATAGTGAGGAGAGAAAGGAAGG - Intergenic
1029024549 7:97402126-97402148 ACTTGGAGGGAGGGAGAGGAGGG + Intergenic
1029173976 7:98650974-98650996 CCTATGGAGGAGTGAGAGGAAGG + Intergenic
1029503740 7:100949769-100949791 CCTGGGGAGGGGGGATAAGAAGG + Intronic
1029507612 7:100971749-100971771 CCTTGGGAGCAGGGATGGGGAGG - Intronic
1029658881 7:101945830-101945852 CCATAGGTGGAGGGAAGGGAAGG - Intronic
1029702982 7:102259847-102259869 CTTTGGGAGGAGGTCAAGGCAGG + Intronic
1030659474 7:112205133-112205155 AAATGGGAGGAGGAAAAGGAAGG + Intronic
1030706503 7:112698038-112698060 CCGTGGGAAGAGGGAGAGGGAGG + Intergenic
1030771913 7:113485623-113485645 GCTGGGGAGAAGGGTAAGGAAGG - Intergenic
1030925014 7:115441047-115441069 ACATGGAAGGAAGGAAAGGAAGG + Intergenic
1030960295 7:115912062-115912084 CTTTGGGAAGAGTGAAAAGATGG - Intergenic
1031446281 7:121858492-121858514 CCTTGGGAGGAAGGTAGGGAGGG + Intergenic
1032020848 7:128406348-128406370 CCTGGGGAGAAGGGCAAGGTGGG - Intronic
1032052871 7:128659912-128659934 CCTTGGGTGGAATGACAGGAGGG + Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032482267 7:132256540-132256562 GCTAAGGAGGAGGGAAAGGCAGG + Intronic
1032569344 7:132983980-132984002 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1032788002 7:135216389-135216411 ACGTGGGAGGAGGGTGAGGAAGG + Intergenic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1033225539 7:139559559-139559581 CCTCGGGAGAGAGGAAAGGACGG + Intergenic
1033641670 7:143267887-143267909 CCTTGGGCTCAGGGAAAGGAAGG + Intronic
1033825760 7:145187118-145187140 CCCTGGAAGGAAGGAAGGGAAGG - Intergenic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034283036 7:149866628-149866650 CCTTAGGTGGTGGGAAAGGGGGG + Exonic
1034494365 7:151410804-151410826 CCTAGGGAGAAGGGCAAGGAAGG + Intergenic
1034918658 7:155061072-155061094 CCTTGGCAGATGGGAGAGGAAGG - Intergenic
1035059475 7:156058438-156058460 CCTTAAGAGGAGGAAAAGGCCGG - Intergenic
1035070863 7:156144008-156144030 CCTCTGGCAGAGGGAAAGGATGG + Intergenic
1035262456 7:157670652-157670674 CCGTGGGAGCCGGGAAGGGAGGG - Intronic
1035574474 8:696084-696106 GATGGGGAGGAGGGAGAGGAAGG - Intronic
1035625616 8:1068595-1068617 TGTGAGGAGGAGGGAAAGGATGG + Intergenic
1035734919 8:1881132-1881154 CTGTGGGAAGTGGGAAAGGAAGG + Intronic
1036183782 8:6607138-6607160 CCAGGGGAGAAGGGCAAGGAGGG - Intronic
1036287707 8:7459379-7459401 CCGTGGAAGGAAGGAAAGGCTGG - Intronic
1036333770 8:7852149-7852171 CCGTGGAAGGAAGGAAAGGCTGG + Intronic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1037834422 8:22207675-22207697 CCTGGGGGGCAGGGATAGGAGGG + Intronic
1038022865 8:23564508-23564530 GGGTGGGAGGAAGGAAAGGAGGG + Intronic
1038423770 8:27451566-27451588 CCCTGGGCGGTGGGCAAGGATGG - Intronic
1038789504 8:30656355-30656377 CCTTGGGAGGAGGGAAAGCGTGG + Intronic
1039201184 8:35095085-35095107 CCATGGGGAGAGGGAGAGGAGGG + Intergenic
1039248650 8:35636726-35636748 CCTTGTGAGAACAGAAAGGAAGG - Intronic
1039504667 8:38043249-38043271 GTTTGGGAGGAGGTTAAGGAAGG + Intronic
1040782195 8:51122360-51122382 TCTTGGGAGGAGGGAGAGTTTGG - Intergenic
1040888747 8:52293342-52293364 TCTAGGGAAGAGGGAAAGGCTGG + Intronic
1040961634 8:53040055-53040077 GGTTGGGAGGGGGGTAAGGATGG - Intergenic
1041084692 8:54245991-54246013 GCTTGGGAGGATGGAGAGCAAGG - Intergenic
1041339382 8:56826295-56826317 ACATGGGAAGAGGAAAAGGAAGG + Intergenic
1041360324 8:57046190-57046212 GCTGAGGAGGAGGAAAAGGAAGG + Intergenic
1041516137 8:58700700-58700722 CCTGGGAAGGAAGGAAAGAAGGG + Intergenic
1041673158 8:60513071-60513093 CTTTGGGAAGAGGGATAGGGTGG - Intergenic
1041719981 8:60966852-60966874 CATTGGGTGGAGAGAGAGGAAGG + Intergenic
1041761357 8:61370350-61370372 ACTTGGGGGGAAGGATAGGAGGG - Intronic
1041881895 8:62761330-62761352 CCTGGGGAGGTGGGGGAGGACGG + Intronic
1042102629 8:65290025-65290047 CCAGGGGAGGAGGAAAAGTATGG + Intergenic
1042214511 8:66416658-66416680 CCCTGGGAGGGTGGAAAGGATGG + Intergenic
1042223823 8:66499477-66499499 CTTTGGGAGGAGGCAGAGGCAGG - Intronic
1042274062 8:66985081-66985103 CCTAGGAAGGAGCTAAAGGAAGG - Intronic
1042413527 8:68492470-68492492 CCTTGGGAGGCTGAGAAGGAAGG - Intronic
1042726395 8:71882368-71882390 CCTTGGGAGGAAGGATGGCAGGG - Intronic
1043654575 8:82646140-82646162 CCTTGGGGAAAGTGAAAGGAAGG + Intergenic
1043671316 8:82888175-82888197 GCTGGGATGGAGGGAAAGGAAGG + Intergenic
1043746925 8:83886131-83886153 ACTGAGGAGGAGGAAAAGGAAGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044125831 8:88457261-88457283 CCCTGTGAGGAGGAACAGGATGG - Intergenic
1044843925 8:96361497-96361519 CCTGGAGTGGCGGGAAAGGATGG + Intergenic
1044858384 8:96497880-96497902 CCTTGGGAAGAAGAAAAGGATGG - Intronic
1044875997 8:96666932-96666954 ACTTGATAGAAGGGAAAGGAAGG - Intronic
1045047014 8:98288874-98288896 TGATGGGAGGAGGGAAAGGGAGG - Intronic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045414539 8:101952975-101952997 CGTGGGGATGAAGGAAAGGAGGG - Intronic
1045539513 8:103069949-103069971 CCTTGGGAGGTGGAAATTGAGGG - Exonic
1046183522 8:110683591-110683613 ACTTGGGGGGAGGGATGGGAGGG + Intergenic
1046612612 8:116442551-116442573 CAATGGGAGGAGGGCAAGGGTGG - Intergenic
1047507285 8:125489776-125489798 CATTCTGAGGAGGAAAAGGAAGG - Intergenic
1047606371 8:126478580-126478602 CTTTGGGAGGAGGCAGAGGCAGG - Intergenic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1048213859 8:132479170-132479192 ATTTGGGAGGGGGGAGAGGATGG - Intronic
1048296335 8:133217330-133217352 CCATGGGAGGTGTGAAGGGAGGG + Intronic
1048336083 8:133503503-133503525 CGGAGGGAGGAAGGAAAGGAAGG - Intronic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048527984 8:135221898-135221920 CCCTTGGAGGACGGTAAGGAAGG - Intergenic
1048926210 8:139274469-139274491 GCTTGGAGGGAAGGAAAGGAGGG - Intergenic
1048972591 8:139653608-139653630 CCTTGGGGTGAGGGAAGGGGTGG - Intronic
1049110255 8:140637731-140637753 GGTTGGGAGGAGGGTAGGGATGG - Intergenic
1049194327 8:141307501-141307523 CACTGGGCAGAGGGAAAGGAGGG + Intronic
1049398557 8:142413169-142413191 GCTTGGTAGGAGGGGCAGGATGG - Intergenic
1049543780 8:143220251-143220273 CCTAAGGAGGAGGAAAGGGATGG - Intergenic
1049597625 8:143492012-143492034 CCTGGGGAGGAGGGCAGAGAAGG + Intronic
1049938715 9:524246-524268 GCTGGGGAAAAGGGAAAGGAAGG - Intronic
1050143251 9:2538628-2538650 GGTGGGGAGGAGGGAAGGGAAGG - Intergenic
1051068055 9:13128775-13128797 TCTTGGGAGAAGGGAGAGGATGG - Intronic
1051165044 9:14252933-14252955 GCATGGAAGGAAGGAAAGGAGGG + Intronic
1051680950 9:19607471-19607493 CATTGGGAGGAGGCCAAGGCAGG + Intronic
1052792613 9:32889819-32889841 GCTTGGGAGGGGGGTATGGAGGG + Intergenic
1052934137 9:34078915-34078937 CTTTGGGAGGAGGCCAAGGTGGG + Intergenic
1053014383 9:34653787-34653809 CCTTGGGTGGGAGGGAAGGAGGG + Intronic
1053426114 9:38011173-38011195 CCTGGGGAAGAGGGAAAGAAGGG + Intronic
1053901551 9:42800444-42800466 TCTTGGGAGGAGGGCAGGTATGG + Intergenic
1054873410 9:70070192-70070214 CCTTGGGAGGAGAAAAAGCAAGG + Intronic
1055980776 9:81997968-81997990 CCTTGGAAGGAAACAAAGGAGGG - Intergenic
1056154043 9:83817542-83817564 CGGGGGGAGGAGGGAGAGGAGGG - Exonic
1056236591 9:84600684-84600706 ACATGGAAGGAAGGAAAGGACGG - Intergenic
1056325836 9:85478314-85478336 CCTTGTTAGAAGGGAAGGGAAGG - Intergenic
1056356454 9:85805551-85805573 CGGGGGGAGGAGGGAGAGGAGGG + Intergenic
1056544046 9:87598299-87598321 ACTTGGGAGGAGCGTAAAGATGG + Intronic
1056870273 9:90270974-90270996 GGTTGGAAGGAGGGAGAGGATGG - Intergenic
1057915130 9:99049596-99049618 CCTCCAGAGGAAGGAAAGGAGGG - Intronic
1057923152 9:99116263-99116285 CCATGGGAGAAGGGAAAGGAGGG + Intronic
1058456271 9:105140947-105140969 CCTTGAGAGGAAGGAGAGCAGGG - Intergenic
1058569412 9:106324605-106324627 ACTTAGGAGGAGGGAGTGGAGGG + Intergenic
1059257913 9:112947688-112947710 CCCTGGGAGGCGGGACAGAATGG + Intergenic
1059434223 9:114266672-114266694 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1059892730 9:118822144-118822166 CCAAGGGATGAGGGAAGGGAGGG - Intergenic
1060266099 9:122112204-122112226 GGATGGGAGGAGGGGAAGGATGG - Intergenic
1060899241 9:127242994-127243016 CTTTGGGAGGAGGGTAAAGCAGG + Intronic
1061022795 9:128027085-128027107 CCCTGGGAGGAGGGAAGGGCAGG - Intergenic
1061176680 9:129001863-129001885 CCCTGGGAGGAGGGAAAGACAGG - Exonic
1061484919 9:130915319-130915341 CCTTGGGCAGAGGCAAAGGCAGG - Intronic
1061537764 9:131260150-131260172 TCTTGGGAGAAGGGTGAGGATGG - Exonic
1061917270 9:133761851-133761873 CCAGGGGAGGAGGGAATGGCTGG - Intergenic
1062281736 9:135754939-135754961 CATAAGGAGGAGGGAAGGGAAGG - Intronic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1062359626 9:136181696-136181718 CTTGGGGAGGAAGGAAAGGAAGG + Intergenic
1062713361 9:137988795-137988817 CCTTTGGAGGAGGCTGAGGAGGG + Intronic
1185797272 X:2977180-2977202 GCTGAGGAGGAGGAAAAGGAGGG - Intergenic
1185966794 X:4614697-4614719 AGATGGGAGGAGAGAAAGGATGG + Intergenic
1186202504 X:7168654-7168676 GCCTGGGTGCAGGGAAAGGAGGG - Intergenic
1186506645 X:10098879-10098901 TATTGGAAGGAGGGAAGGGAAGG - Intronic
1186970663 X:14839045-14839067 CTTTGGGAGGAGGTCGAGGAGGG + Intergenic
1187563548 X:20425690-20425712 CAATTGAAGGAGGGAAAGGAGGG - Intergenic
1187631294 X:21175527-21175549 CCTTGGCACAAGGGAAAGAAAGG + Intergenic
1187953479 X:24493225-24493247 ACTTAGGATGAGGGAAATGAGGG + Intronic
1187954124 X:24498743-24498765 TCTTAGGAAGAGGGAGAGGAGGG + Intronic
1188542279 X:31264258-31264280 GCTAGGGAGGAGGGAGTGGAAGG + Intronic
1189112539 X:38307291-38307313 CCTTGGGATCAGGGAAACCATGG - Intronic
1189424142 X:40882846-40882868 CCTGGGGGGCAGGGAAAGGTGGG - Intergenic
1190773943 X:53537696-53537718 TCTTGGGAGGTAGAAAAGGAAGG + Exonic
1190820130 X:53966217-53966239 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1192177487 X:68895035-68895057 CTCGGGGAGGAGGGAGAGGAGGG - Intergenic
1192208293 X:69110378-69110400 CCCTGGGAGGAAGGAGGGGATGG - Intergenic
1192359924 X:70433012-70433034 CCTGGGGAGGAGGGGGAGGGTGG - Exonic
1192381112 X:70617667-70617689 ACTTGGAAGGATGGGAAGGATGG + Intronic
1192452163 X:71251368-71251390 CCTTAGGAGGAGGGAAGAAAAGG + Intronic
1192794986 X:74419584-74419606 CCCTGGGAGGAGACAGAGGAGGG - Intergenic
1192866433 X:75137880-75137902 CAATGGGAGGAGGGAGAGCATGG + Intronic
1194863845 X:99040529-99040551 ACTTGGGAGGAAGAATAGGAAGG - Intergenic
1195030870 X:100926830-100926852 AGTTGGGAGGGGGCAAAGGAAGG - Intronic
1195641596 X:107181628-107181650 TCTTTGGGGGAAGGAAAGGAAGG - Intronic
1196339824 X:114583527-114583549 CTTTGGGGTTAGGGAAAGGATGG + Intergenic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1197365846 X:125563621-125563643 TCTTGGGAGCAGGGGGAGGAGGG + Intergenic
1197944103 X:131819751-131819773 CATTGGGAGGATGGGAAGAAAGG - Intergenic
1198006803 X:132503247-132503269 CCAGAGGAGGAGGGAAAGGAAGG + Intergenic
1198214272 X:134542776-134542798 GCTGGGGAGGAGGGAAAAGGTGG + Intergenic
1198642794 X:138775200-138775222 CTTTGGGAGGAGAAAAAGGGTGG - Intronic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1199881570 X:151977488-151977510 GTTGGGGAGGAGGCAAAGGAGGG + Intergenic
1200123031 X:153800196-153800218 CCTTGGGAGGGGGGTTGGGAGGG + Intergenic
1200234723 X:154462730-154462752 CATGGGTAGGAGGGGAAGGATGG - Intronic
1200240413 X:154490357-154490379 ACCTGGGAGGGAGGAAAGGAAGG + Exonic
1200406605 Y:2818311-2818333 CTTTGGGAGGAGGCCAAGGCAGG + Intergenic
1200957966 Y:8970556-8970578 CAGAGGGAGGAGGGAAAGGATGG - Intergenic
1201073610 Y:10170929-10170951 CCTTGGAAGGGAGGAAGGGAGGG - Intergenic