ID: 1075904866

View in Genome Browser
Species Human (GRCh38)
Location 10:126072335-126072357
Sequence CAGCCCTTCTAGAGCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075904866_1075904868 -2 Left 1075904866 10:126072335-126072357 CCTTCTGTGCTCTAGAAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1075904868 10:126072356-126072378 TGCCCAGCCCCCATGTACCTGGG No data
1075904866_1075904867 -3 Left 1075904866 10:126072335-126072357 CCTTCTGTGCTCTAGAAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1075904867 10:126072355-126072377 CTGCCCAGCCCCCATGTACCTGG No data
1075904866_1075904871 1 Left 1075904866 10:126072335-126072357 CCTTCTGTGCTCTAGAAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1075904871 10:126072359-126072381 CCAGCCCCCATGTACCTGGGTGG No data
1075904866_1075904872 2 Left 1075904866 10:126072335-126072357 CCTTCTGTGCTCTAGAAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1075904872 10:126072360-126072382 CAGCCCCCATGTACCTGGGTGGG No data
1075904866_1075904878 19 Left 1075904866 10:126072335-126072357 CCTTCTGTGCTCTAGAAGGGCTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1075904878 10:126072377-126072399 GGTGGGCTGTATGACATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075904866 Original CRISPR CAGCCCTTCTAGAGCACAGA AGG (reversed) Intronic
900338552 1:2176859-2176881 CAGCCCTTCCAGAGCCCAGCTGG + Intronic
901033056 1:6319744-6319766 CAGCCCTTCCAGAGCAGATGGGG + Intronic
901195331 1:7437011-7437033 CAGCCCCTCTGGGGCACAGCTGG + Intronic
902399561 1:16150602-16150624 CAGCCCTTCTGGAACATGGAAGG + Intronic
903999740 1:27332162-27332184 CAGGCCTTCTGGGGCACAGGAGG + Intronic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
906773374 1:48505593-48505615 CAGCACTTGTTGAGCACTGAAGG + Intergenic
907307407 1:53521014-53521036 CAGCCCATCTAGTTCACAGATGG - Intronic
907784733 1:57600426-57600448 CAGCCTTTCTAGAACAAAGCAGG + Intronic
907941573 1:59093410-59093432 CAGTCCTTGTTGTGCACAGAGGG - Intergenic
912692540 1:111815198-111815220 CAGCCCTCCGAGAGCTGAGATGG - Intronic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
915658344 1:157380448-157380470 CATCCCTTATGGACCACAGAAGG - Intergenic
916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG + Intronic
917537317 1:175883763-175883785 CAGCCCTTTTGGTGCCCAGATGG - Intergenic
918102308 1:181387081-181387103 CAGCCCTCCGAGAGTACACAGGG + Intergenic
918311375 1:183287879-183287901 CTGCCCTTCTAGGGCTCAGAAGG - Intronic
920217605 1:204372327-204372349 CATCCAATCTAGAGCCCAGAGGG - Intronic
922089568 1:222382732-222382754 CAGACCATCAAGAGTACAGAAGG + Intergenic
922880330 1:228975670-228975692 CAGGCCTCCAAGAGCACAGCGGG - Intergenic
924598301 1:245465884-245465906 CAGCCCTTGGAGAGCGCAGAAGG - Intronic
1066576392 10:36829773-36829795 CTGGCCATCTATAGCACAGAAGG - Intergenic
1067343596 10:45422548-45422570 CAGGCCTTCTAGTGTCCAGAGGG - Intronic
1068246484 10:54377796-54377818 CAGTCTTTCTTGAGTACAGAGGG - Intronic
1071861615 10:89679882-89679904 CAGACCATCCAGAGCTCAGAAGG + Intergenic
1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG + Intergenic
1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG + Intergenic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1076576332 10:131472225-131472247 CAGCCCTCCGAGAGGATAGAAGG + Intergenic
1077334879 11:1998773-1998795 CAGCCCTTCCACATCCCAGAGGG - Intergenic
1080653946 11:34243922-34243944 CTGCTCTTCTAGAGTACTGAGGG - Intronic
1081204248 11:40256440-40256462 GAGCCATTCTAGGGCAGAGAAGG - Intronic
1083621113 11:64049871-64049893 CAGCCTTTCTAGAACAGAGCTGG - Intronic
1089600902 11:119614288-119614310 CAGCCATGCAAGGGCACAGATGG - Intergenic
1089671662 11:120061459-120061481 TGGCCTTTCTAGAGCACAGGTGG - Intergenic
1090592125 11:128283434-128283456 CACCCATTCCAGACCACAGATGG - Intergenic
1091043931 11:132308972-132308994 CAGCCTTGCTAAAGCAAAGAGGG + Intronic
1091317300 11:134623664-134623686 CAGTCCTTCTGGAGCACTGAAGG + Intergenic
1202817862 11_KI270721v1_random:53955-53977 CAGCCCTTCCACATCCCAGAGGG - Intergenic
1093270656 12:17056750-17056772 CAGTGCTGCTATAGCACAGATGG - Intergenic
1093496447 12:19763295-19763317 CAGCCTTTGTGGAGCCCAGAAGG + Intergenic
1095373303 12:41495945-41495967 CAGCTCTGCAAGAGCACAAAGGG - Intronic
1095989795 12:48026954-48026976 CAGACCTTCCAGAGAAGAGACGG - Intergenic
1101876838 12:108601565-108601587 AAGCCCTTCAACAGGACAGAGGG - Intergenic
1102806675 12:115787509-115787531 CAGCCCTTCTGGGGCCCAGGAGG + Intergenic
1103141210 12:118549930-118549952 CAGCCCTAGGAGAGCACAGCAGG - Intergenic
1103398500 12:120626089-120626111 CAGCCCTTCAAGTGCACACTCGG - Intergenic
1104123485 12:125821253-125821275 AAGCCCTTGTAGAGCAATGATGG + Intergenic
1104944887 12:132411090-132411112 CAGCCCTTCTAGACCCCCCAGGG - Intergenic
1104993079 12:132637358-132637380 CAGCCCTTTCTGAGCACAGAGGG - Intronic
1105403037 13:20112263-20112285 CAGCCTACCTGGAGCACAGATGG + Intergenic
1105578411 13:21673629-21673651 CAGCCCTTAAAGAGGCCAGATGG - Intronic
1105836930 13:24220497-24220519 TATCCCTTCTAGAGCACATGAGG + Intronic
1106599836 13:31178075-31178097 CAAAGCTTCTACAGCACAGAAGG - Intergenic
1106903985 13:34385891-34385913 CAGCCAATCTAGAGCACAGGTGG + Intergenic
1108100335 13:46947578-46947600 CAGCCCTCAGAGAGAACAGATGG + Intergenic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1119756892 14:77125775-77125797 CAGCCCATCCAGGGCACAGTCGG + Intronic
1121340949 14:93104793-93104815 CAGCCCTGCCAAAGCACAGCAGG + Intronic
1202901282 14_GL000194v1_random:41680-41702 CATCCCTGATAGAGCAGAGAGGG + Intergenic
1123875778 15:24622333-24622355 CAGCCTGTGTAGAGCCCAGAGGG - Intergenic
1125749950 15:42021285-42021307 CAGGCCTTCAAGGGCACAGTGGG + Intronic
1127047906 15:55046738-55046760 GAGACCTTCTTGAGCTCAGAAGG - Intergenic
1135541866 16:23336186-23336208 CAGCGAATTTAGAGCACAGAGGG - Intronic
1142159336 16:88548480-88548502 CAGCCCAGCCAGAGCAGAGAAGG - Intergenic
1148336962 17:46848438-46848460 CAGCCCTTCAGGAGCCCACAGGG + Intronic
1152295862 17:79466534-79466556 CAGCCCTTCTGGAGACCACAGGG + Intronic
1155012288 18:21791863-21791885 CAGCACTGCTAGAGACCAGATGG - Intronic
1156960118 18:43017850-43017872 CAGCCCTACCAGCTCACAGATGG - Intronic
1157120054 18:44900805-44900827 CAGCCCTTCTCAAGCAGAGTTGG - Intronic
1158613025 18:58960502-58960524 CAGCCATTTCAGAGAACAGATGG + Intronic
1158874397 18:61719237-61719259 CAGCCCTTAGAGAGAATAGATGG + Intergenic
1160343827 18:78112873-78112895 CAGCCTTTCTTGTACACAGAGGG + Intergenic
1163764317 19:19154062-19154084 CAGCCCTCCTCCAGCTCAGAAGG - Intronic
1166418216 19:42611354-42611376 CAGCCCTCCTAGAGAATGGATGG - Intronic
1168267545 19:55230816-55230838 CAGCCCCCCCAGACCACAGAAGG - Exonic
924966524 2:81508-81530 CTGCCTCTCTAGAACACAGACGG - Intergenic
926358607 2:12064311-12064333 CAGGGCTTCGGGAGCACAGAGGG - Intergenic
927044868 2:19267018-19267040 CAGTCATTCTAGGGCACTGATGG - Intergenic
927808448 2:26168806-26168828 CACCCCATCTAGAGGACAGATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
934868783 2:97840387-97840409 CAGCCCTTCTACGGCACAGTGGG + Intronic
936097600 2:109544284-109544306 CAGAAGTTCCAGAGCACAGAAGG - Exonic
937916170 2:127100010-127100032 CAGCAGTTCTAGACCACAGCTGG - Intronic
938203797 2:129399960-129399982 CAGCCTGTATAGAGCACAGATGG + Intergenic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
947120057 2:226804594-226804616 CATCTCTTCTAGAGAACTGAGGG + Intergenic
1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG + Intronic
1172965641 20:38832588-38832610 CAGCCATTCTGGAGAACAGTTGG + Intronic
1173928959 20:46802511-46802533 CAGCCATTCTAAAGAACAGCAGG - Intergenic
1174076303 20:47939770-47939792 CAGCCCTAATAGAGGTCAGAGGG - Intergenic
1174779259 20:53373276-53373298 CATTCCTCTTAGAGCACAGAGGG - Intronic
1175659902 20:60803639-60803661 CAGCCCTTCATGAGCGAAGAGGG - Intergenic
1176620657 21:9056458-9056480 CATCCCTGATAGAGCAGAGAGGG + Intergenic
1177428410 21:20956788-20956810 CAGCCCCTCTAGTGTACTGAAGG + Intergenic
1179486552 21:41714177-41714199 CCGCCCTTCTACAGCACCGGTGG + Intergenic
1181742110 22:24929465-24929487 CAGGCCTTGGAGAGGACAGAGGG - Intergenic
1182256860 22:29045405-29045427 TAGCCCTTTTAGAACAGAGAAGG - Intronic
1182354086 22:29714439-29714461 AAGCACTTCTAGGGCAGAGATGG - Intergenic
1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG + Intronic
1183828216 22:40404829-40404851 AAGCCCTTCCACAGCACTGATGG - Intronic
1185403250 22:50629406-50629428 CAGCCCTGAGAGAGAACAGATGG - Intergenic
1185404517 22:50640010-50640032 CAGCCCTGAGAGAGAACAGATGG - Intergenic
949268669 3:2188989-2189011 CAGTCCCTCTAGAGCACTGAAGG - Intronic
951642049 3:24847170-24847192 CAGGGCTTATAAAGCACAGACGG - Intergenic
954628875 3:52037622-52037644 CAGCCCTTCGGGAGCAGAGCTGG + Intergenic
956002189 3:64741297-64741319 CAGCTCTTGTAGAGAATAGATGG + Intergenic
957402407 3:79733526-79733548 CAGCCCATCTTTAGCACTGATGG - Intronic
957853768 3:85846336-85846358 CAGTCATTCTAGAGGACAGTGGG - Intronic
957984674 3:87558542-87558564 CAGCCCTTAGAGAGAATAGATGG + Intergenic
964005041 3:151816907-151816929 CAGCCCTCAGAGAGAACAGATGG + Intronic
965281264 3:166756605-166756627 CATCTCTTCTAGAAAACAGAAGG + Intergenic
965716851 3:171614026-171614048 CAGCCCTACCAGAGCTCAAATGG + Intronic
967415510 3:189213463-189213485 AAGCCCTTATAGAACACAGAAGG - Intronic
967989797 3:195122301-195122323 CAGCCCTTTTAGACTACTGAGGG - Intronic
968689939 4:1985162-1985184 CAGCCCATCTTGAGCACAGAAGG + Intronic
974166739 4:58214079-58214101 CAGCCCTCATAAAGAACAGATGG + Intergenic
975912056 4:79278587-79278609 AAGCCCTTCTAGACCACTCAGGG + Intronic
976354879 4:84105542-84105564 CACCCTATTTAGAGCACAGAAGG - Intergenic
982845355 4:160246122-160246144 CAGCCTTTCTGGAACACAGCAGG - Intergenic
983444276 4:167829445-167829467 CAGGCATACTAAAGCACAGAAGG - Intergenic
984325242 4:178242329-178242351 CAGCTCTCAGAGAGCACAGAGGG - Intergenic
986496240 5:8344586-8344608 CAGGCCTGCCAGTGCACAGAAGG - Intergenic
986985305 5:13494136-13494158 CAGCCTGTATAGAGCCCAGAGGG - Intergenic
990338079 5:54794521-54794543 CAGCCTTGCTAGAGCACGGGAGG - Intergenic
990997403 5:61746171-61746193 CAGCACATCTTGGGCACAGAGGG + Intronic
991243894 5:64489077-64489099 CAGCCTGTGTAGAGCCCAGAGGG + Intergenic
993429422 5:87813807-87813829 CAGCCTCTGTGGAGCACAGAGGG + Intergenic
995821458 5:116238555-116238577 TAGTCCTTCTATGGCACAGAGGG - Intronic
996514912 5:124358752-124358774 CAGGCCTTCTAGAGCTGAGGTGG - Intergenic
999016282 5:148109703-148109725 GAGCTCTTCTAAATCACAGAAGG - Intronic
999033092 5:148316320-148316342 CAGCTCTTCTAGAGTGCTGATGG + Intergenic
999454972 5:151707698-151707720 CAGCTGTTCTAAAACACAGATGG - Intergenic
1001084982 5:168693852-168693874 CAGCCTCTCAAGACCACAGAAGG + Intronic
1001657316 5:173361581-173361603 CACCCCTGCTAGAACACCGAAGG - Intergenic
1002947300 6:1775120-1775142 CAAGCCTTCTAGAGAAGAGATGG + Intronic
1004383016 6:15148749-15148771 CAGACATTCTGGAGAACAGAAGG - Intergenic
1004806851 6:19211689-19211711 TAGCCTTTGTAGAGCCCAGACGG - Intergenic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1007353645 6:41294248-41294270 CAGCCTGTGTAGAGCCCAGAGGG + Intergenic
1007825057 6:44594292-44594314 CAGCCCCTCTGGAGCAGCGAGGG + Intergenic
1012490818 6:99780632-99780654 CAGCCAATGTAGAGCCCAGAGGG - Intergenic
1013043269 6:106457812-106457834 CAGCACTGATAGAGCACATAGGG - Intergenic
1013651524 6:112199887-112199909 CAGGCCCTCAACAGCACAGATGG - Intronic
1016325475 6:142896437-142896459 CAGCCCCTCTAGATTACATAGGG - Intronic
1016954420 6:149612548-149612570 AAACTCTTCCAGAGCACAGAAGG + Intronic
1018303951 6:162434384-162434406 TAGCCTTTGTAAAGCACAGAAGG - Intronic
1018435272 6:163753317-163753339 CAGCCCCTCTAGAGGGCTGAGGG + Intergenic
1019478564 7:1255644-1255666 CAGCCCCTCCAGGGCACAGCAGG + Intergenic
1020763893 7:12297795-12297817 CAGCCCTTGGAGAGAATAGATGG - Intergenic
1021450004 7:20776525-20776547 CAGTCATTCTTTAGCACAGAGGG - Intronic
1024548186 7:50539514-50539536 CAGCCCTGGTGGAGAACAGAAGG + Intronic
1026375513 7:69746650-69746672 CAGCCTGACTAGAGCAGAGAGGG + Intronic
1027869396 7:83687603-83687625 CCGCACTTCTATAGCAAAGATGG + Intergenic
1028406132 7:90476028-90476050 TATACCTTCTAGAGCACAGCTGG - Intronic
1029067536 7:97866829-97866851 CATCCCTGATAGAGCAGAGAGGG - Intronic
1029218764 7:98971075-98971097 CACCCCTTTTAGAGCAAAGAAGG - Intronic
1029668824 7:102014440-102014462 CAGCCCTTGGAGACCCCAGAGGG - Intronic
1032458690 7:132093424-132093446 CAGCCTCTCTAGAGTACATATGG + Intergenic
1032650148 7:133869109-133869131 AAGCCATTCTAGAGCACTCAGGG + Intronic
1033195391 7:139322871-139322893 CAGCCTTTCCAGGACACAGAAGG - Intergenic
1033233005 7:139616296-139616318 CCAGCCTTCTTGAGCACAGAGGG + Intronic
1034877411 7:154737783-154737805 CACACCTTTTACAGCACAGATGG - Intronic
1035675854 8:1455154-1455176 GAGCCCGTCTAAAGCCCAGAGGG + Intergenic
1036010487 8:4716203-4716225 CTGCTCATCTAGAGAACAGAAGG + Intronic
1036212555 8:6854149-6854171 CAGCAGTTCTGGGGCACAGAGGG + Intergenic
1036236928 8:7047174-7047196 CTTCCCTTCTAGAGTACGGAGGG + Intergenic
1038651004 8:29403136-29403158 TAGATCTTCTAGAGCAGAGAAGG + Intergenic
1041083289 8:54233789-54233811 CAGCCCTCAAAGAGAACAGATGG - Intergenic
1041307420 8:56476802-56476824 CAGAAGTTCCAGAGCACAGAAGG - Intergenic
1043485837 8:80698469-80698491 AAGCCCTTATAGAGCATGGAAGG - Intronic
1043738243 8:83774772-83774794 CAGCTCTTACAGACCACAGAGGG + Intergenic
1044540517 8:93404017-93404039 AAGCCCTTCTTGAACACACAAGG - Intergenic
1044802650 8:95973056-95973078 CAGCCTTCCTAGAGTACAGAAGG + Intergenic
1045242959 8:100418299-100418321 CAGCTCTGCTACAGCACAGCTGG - Intergenic
1048616340 8:136079612-136079634 CAGCCCTTCTGCAGCATTGAAGG - Intergenic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1051144781 9:14015578-14015600 CAGCTCTTGTAGGTCACAGAAGG - Intergenic
1052109788 9:24567120-24567142 CAGACCTTGTAGAGCAGAAATGG + Intergenic
1053162480 9:35822993-35823015 CTGCCCTTCTAGAGCAGAGTGGG + Intronic
1054328378 9:63729336-63729358 CTGCCCCTCTAGCCCACAGATGG + Intergenic
1054355528 9:64057780-64057802 CATCCCTGATAGAGCAGAGACGG + Intergenic
1056977359 9:91270594-91270616 CACCCCTTGTAGAGCAAAAAGGG + Intronic
1057230670 9:93319640-93319662 CGGCCCATCTGGAGCAAAGAGGG - Intronic
1058184618 9:101839992-101840014 CAGATCTTTTAGAGCACTGACGG - Intergenic
1058411566 9:104738817-104738839 CAGCCCTTTGAGAGGCCAGAGGG - Intergenic
1058439337 9:104992649-104992671 CAACCCTTCTAGAAGACAGTTGG + Intergenic
1058634527 9:107023599-107023621 AAGACCTTATAGAGAACAGACGG + Intergenic
1059148642 9:111926616-111926638 CAGGGCTTCTAGAACACAGCAGG - Intronic
1060670187 9:125461910-125461932 CAGCCCTGCTGGTGCACTGAGGG - Intronic
1062006356 9:134240279-134240301 GAGCCCTTCAGGAGCACAGATGG - Intergenic
1062709784 9:137968614-137968636 TAACCCTTCTAGAGGACAGTGGG - Intronic
1203743866 Un_GL000218v1:26901-26923 CATCCCTGATAGAGCAGAGAGGG + Intergenic
1203566248 Un_KI270744v1:92631-92653 CATCCCTGATAGAGCAGAGAGGG - Intergenic
1186013415 X:5163880-5163902 CAGCCCTTGGAGAGAATAGATGG - Intergenic
1187101704 X:16199478-16199500 CAGCCCTTAGAGAGAATAGATGG - Intergenic
1190424490 X:50320165-50320187 CATCCCTTCCAGAAAACAGAAGG - Intronic
1191166028 X:57393111-57393133 CTGCCTTTCCAGAGAACAGAGGG - Intronic
1194972539 X:100359901-100359923 GAGCCCTTCTGGCTCACAGAAGG + Intronic
1198389232 X:136157283-136157305 AATCCCTTCTAGGCCACAGAAGG + Intronic
1199912991 X:152307909-152307931 CTGCCTTTGTGGAGCACAGAGGG + Intronic
1201157189 Y:11141886-11141908 CATCCCTGATAGAGCAGAGAGGG + Intergenic
1201685870 Y:16701923-16701945 CTCCCCTTTTAGAGCACAGAGGG - Intergenic