ID: 1075907429

View in Genome Browser
Species Human (GRCh38)
Location 10:126093768-126093790
Sequence CATGGTGTGTACAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075907429_1075907438 22 Left 1075907429 10:126093768-126093790 CCCTCTTCCTTGTACACACCATG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1075907438 10:126093813-126093835 ATGGCTCTCCAGAGTAGCACAGG 0: 1
1: 0
2: 1
3: 6
4: 119
1075907429_1075907432 -7 Left 1075907429 10:126093768-126093790 CCCTCTTCCTTGTACACACCATG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1075907432 10:126093784-126093806 CACCATGTAGCATTGCCATCTGG 0: 1
1: 0
2: 0
3: 9
4: 92
1075907429_1075907434 3 Left 1075907429 10:126093768-126093790 CCCTCTTCCTTGTACACACCATG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1075907434 10:126093794-126093816 CATTGCCATCTGGCTGCCCATGG 0: 1
1: 0
2: 1
3: 11
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075907429 Original CRISPR CATGGTGTGTACAAGGAAGA GGG (reversed) Intronic
900285736 1:1899515-1899537 CATGGTGAGGTCAAGGACGAAGG + Intergenic
900462033 1:2806149-2806171 CAAGGTCTGTTGAAGGAAGAAGG - Intergenic
900991238 1:6099344-6099366 ATTGGTGTGTAGGAGGAAGACGG - Exonic
905172878 1:36119444-36119466 CATGGTGTGTACTGGGGTGAAGG + Intronic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
906114580 1:43348369-43348391 CATCATGTGTACAAGCAGGAAGG - Intronic
906483699 1:46218757-46218779 ACTGGTGTGTACAGGCAAGAAGG + Intronic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
910037394 1:82804655-82804677 CATGGTGGGTATAAGTTAGAGGG - Intergenic
914355899 1:146884292-146884314 GATGGTATGTAGAAGAAAGAAGG - Intergenic
917645465 1:177024886-177024908 CATGGTGTCTGTGAGGAAGAAGG - Intronic
919467281 1:197937499-197937521 CATTCTGTGTACAAGAAAGAGGG + Intergenic
920326396 1:205168182-205168204 GAAGGTGGGTACCAGGAAGAAGG + Intronic
920396641 1:205651076-205651098 ACTGGTGGGTACAAGGAAGGAGG + Intergenic
920970901 1:210743128-210743150 CATGGGGAGTAGAAGAAAGAGGG + Intronic
923418194 1:233785877-233785899 AATGATGTGTACAAGTAATATGG + Intergenic
923523825 1:234757315-234757337 TTTGGTGTATAAAAGGAAGAAGG + Intergenic
1070916018 10:80155257-80155279 CGTGGTTTCTGCAAGGAAGATGG + Exonic
1071105872 10:82094006-82094028 CATGGAGTTTACAAAGCAGAAGG - Intronic
1072747721 10:97953111-97953133 CATGGTGGGTGCAAGGAGGAAGG - Intronic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1074610137 10:115014052-115014074 CATGGAGTGGACAAGCGAGATGG - Intergenic
1074810036 10:117095015-117095037 TGTGGTGTCTACAAGCAAGAAGG + Intronic
1075907429 10:126093768-126093790 CATGGTGTGTACAAGGAAGAGGG - Intronic
1075912943 10:126141579-126141601 AATGGTGGGTAAGAGGAAGATGG + Intronic
1079479636 11:20865745-20865767 CACAGTGTGTAAAAAGAAGATGG - Intronic
1079613029 11:22456844-22456866 CATGGAGGTTAGAAGGAAGATGG - Intergenic
1080328562 11:31108592-31108614 AAATGTGTGTACAAAGAAGAGGG + Intronic
1080620360 11:33982010-33982032 AATGGTGTGAACCAGGAAGGCGG + Intergenic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1082190163 11:49233357-49233379 CATCATGGGTACCAGGAAGATGG - Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083451745 11:62750792-62750814 AATGGTGTGAACCAGGAAGGCGG + Intronic
1084802935 11:71557105-71557127 CATTGTATGTGCAAGCAAGAGGG - Intronic
1086675964 11:89607555-89607577 CATCATGGGTACCAGGAAGATGG + Intergenic
1089157888 11:116415985-116416007 CAAGGTGTGTACAAGAGTGAGGG + Intergenic
1090444571 11:126752865-126752887 CATGTTTTATACAAAGAAGAGGG - Intronic
1090561936 11:127941893-127941915 CTTGTTGTTTACCAGGAAGAAGG - Intergenic
1091190888 11:133694406-133694428 CCTGGGGAGTACAAGGCAGAAGG + Intergenic
1091304060 11:134525594-134525616 CAGGGTGTGTGCACAGAAGAGGG - Intergenic
1091826715 12:3518281-3518303 CCTGCTGTTTACAAGGAAGAGGG - Intronic
1092786299 12:12030048-12030070 CATGGTGTGTGCAAGGAACTAGG + Intergenic
1093434651 12:19122625-19122647 CATGGAGAATAAAAGGAAGAAGG - Intergenic
1093556212 12:20477396-20477418 CATGCAGTTTGCAAGGAAGAAGG + Intronic
1094749922 12:33394161-33394183 CATGGTAAGTAAAAGGAAGCTGG - Intronic
1095832828 12:46605377-46605399 CATGCTGAGTATAGGGAAGAGGG - Intergenic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1097915530 12:65017065-65017087 TATGGTGTCTACAAAGAGGAAGG - Intergenic
1103434103 12:120911451-120911473 AATGGTGTGAACAAGGGAGAAGG + Intergenic
1104996510 12:132661141-132661163 TATGCTGTGTTCAATGAAGACGG - Exonic
1105746710 13:23383866-23383888 GATGGTGTGAACAAGGGATATGG - Intronic
1105913294 13:24891113-24891135 CATGGAGTTTACCAGGGAGAAGG - Intronic
1106504472 13:30359301-30359323 GAAGGTGTGTAGAAGGAAGTGGG + Intergenic
1108604132 13:52020358-52020380 AAGGGTGTGTACCAGGAAGTAGG - Intronic
1109056408 13:57555198-57555220 AATGGTGTGAACAAGGGAGGCGG - Intergenic
1110762082 13:79241832-79241854 AATGGAGTGTCCCAGGAAGATGG - Intergenic
1110886388 13:80642374-80642396 CAAGTTGTGTGCATGGAAGAGGG - Intergenic
1111413841 13:87912605-87912627 CGTCTTGTGTACAAGGCAGAGGG + Intergenic
1111489766 13:88956622-88956644 CATTGTGTGTTTAAGGCAGATGG + Intergenic
1117291471 14:54337985-54338007 CGTAGTGTATACAAAGAAGAGGG + Intergenic
1117812103 14:59558164-59558186 CTTGGTGTGTTCGAGGAAGAAGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123147120 14:106142682-106142704 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123149972 14:106171172-106171194 CATGGTGTGGACACCGAGGAAGG + Intergenic
1123223690 14:106879968-106879990 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123583016 15:21732402-21732424 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123619666 15:22174999-22175021 CATGGTGTGGACACTGAGGAAGG + Intergenic
1125457234 15:39872335-39872357 CACGATGTGTACAGAGAAGATGG + Intronic
1125817947 15:42602343-42602365 TATGGTATGTTCAAGGTAGAGGG + Intronic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1127297834 15:57625394-57625416 CATGGTGACTACAAAGAACAAGG + Intronic
1128411235 15:67400441-67400463 CATTGTGTATATAAGGAAAAAGG - Intronic
1130423731 15:83774745-83774767 CATGCTGTGTAGAAGAATGATGG + Intronic
1131925449 15:97378345-97378367 CATGGTGAGTGCATGGAAAAGGG - Intergenic
1134260558 16:12647848-12647870 CTTGGAGGGTACAAGGACGATGG - Intergenic
1134392607 16:13833357-13833379 CTTGGTGGTTAGAAGGAAGATGG - Intergenic
1134698774 16:16246375-16246397 CCTGGTGTGTAGCAGGAATATGG + Intronic
1134973060 16:18548298-18548320 CCTGGTGTGTAGCAGGAATATGG - Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1136871972 16:33815969-33815991 CATGGTGTGGACACTGAGGAAGG - Intergenic
1137717549 16:50607981-50608003 CAGGGTGTGTGCAAGGAATCAGG + Intronic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1140150389 16:72357564-72357586 CATGGTGTGTGTAGGGAGGAGGG - Intergenic
1140676438 16:77336633-77336655 CATGATCTGTACAAGCTAGATGG + Intronic
1142300731 16:89256518-89256540 CATGGTGTGAACCCGGGAGACGG + Intergenic
1203094614 16_KI270728v1_random:1243417-1243439 CATGGTGTGGACACTGAGGAAGG - Intergenic
1203100200 16_KI270728v1_random:1300099-1300121 CATGGTGTGGACACTGAGGAAGG + Intergenic
1142751606 17:1991991-1992013 GACTGTGTGTACAAGGAAGGAGG - Intronic
1143259471 17:5587216-5587238 CTTGGTGTATTCAAGGAACAGGG - Intronic
1143741075 17:8954474-8954496 CACGGTGTTTACAAGGCAGAGGG - Intronic
1143977046 17:10837690-10837712 CTTGCTGTGTACTGGGAAGAAGG - Intronic
1146527273 17:33577754-33577776 CATGGTGTGAACACAGAGGAGGG - Intronic
1147706012 17:42425227-42425249 CATGCTGGGTACAAGGGAGCAGG + Intergenic
1148251316 17:46083543-46083565 CATGGTGGGTACATGGAGGTGGG + Intronic
1148524798 17:48321462-48321484 GATGGTGTGAACCCGGAAGACGG - Intronic
1149382746 17:56110213-56110235 TATGGTGTGTTCAGGGAAGAAGG - Intergenic
1150151480 17:62812474-62812496 CATGCTGTGTGCATGGATGAAGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1155389755 18:25322382-25322404 CATGGTGGGGAAAGGGAAGAAGG - Intronic
1157124884 18:44947075-44947097 GATGGTGTATACAAGCAAGAAGG + Intronic
1158002054 18:52630812-52630834 CTTGCTGTGTACAAGGTAGTAGG - Intronic
1158823756 18:61191043-61191065 TTTGGTGTGTATAAGAAAGAAGG - Intergenic
1159904369 18:74076852-74076874 CATGGTGTGTTCAAGGGTGAAGG - Intronic
1160406846 18:78652261-78652283 CGTGGTGTGTCCCAGGAGGAAGG - Intergenic
1160522941 18:79519168-79519190 CATGGTTTGAACAAGGCAGCAGG + Intronic
1161717540 19:5885222-5885244 GATGGTGTGAACAGGGAAGGCGG + Intronic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1165093594 19:33398871-33398893 CCTTGTGGGTAAAAGGAAGAGGG - Intronic
1165667441 19:37645116-37645138 AATGGTGTGAACCTGGAAGACGG + Intronic
1166637190 19:44460771-44460793 AATGGTGTGAACCTGGAAGATGG + Intergenic
1168200226 19:54809703-54809725 AGAGGTGTGGACAAGGAAGAAGG - Intronic
925009532 2:471611-471633 CCTGGTGTCTACAAGGCAGAAGG + Intergenic
925612430 2:5713019-5713041 CAAGGTGTGTAGAAAGAAGGTGG - Intergenic
926594358 2:14774216-14774238 CATGGTAGGGACAAAGAAGATGG + Intergenic
929759166 2:44791819-44791841 CAAGTTGTATACAAGGAAGCTGG + Intergenic
929854105 2:45621368-45621390 AAGGGTGTGGGCAAGGAAGAGGG + Intergenic
930234345 2:48874591-48874613 CATAGTTTGTAGAAGGAAGGAGG + Intergenic
930580311 2:53203248-53203270 AGTGGAGTGTAAAAGGAAGAAGG - Intergenic
935539220 2:104329603-104329625 AATGGTGTGAACATGGGAGAGGG + Intergenic
936953130 2:117998221-117998243 AATGGTGTGAACACGGATGATGG + Intronic
938313123 2:130307665-130307687 GATTGTGTGTTCAAGGCAGAAGG - Intergenic
941212250 2:162654954-162654976 AATGGTGTTTACCAGGAACAGGG + Intronic
941362308 2:164566250-164566272 CATGGTGTGACCAGGGCAGATGG + Intronic
945150536 2:206785613-206785635 GATGGTGTGGACAAGGAAGTTGG - Intronic
947471974 2:230409116-230409138 TATGGTGTGTTCAGGGAAGGGGG + Intergenic
948708824 2:239812783-239812805 AATGGTGTGAACCCGGAAGAAGG - Intergenic
1169139293 20:3218002-3218024 AATGGTGTGAACAAGGGAGGCGG - Intronic
1169376973 20:5074003-5074025 CATGGTGGGAACAAGCAAGGCGG + Intronic
1169525160 20:6416518-6416540 CATGGTGTGAAGGAGGAAGAGGG - Intergenic
1169765406 20:9142935-9142957 CATGGAGTGAACAAAGGAGAAGG - Intronic
1169788739 20:9387138-9387160 CGTGGTGTGTCCTAGGAAGGCGG - Intronic
1170129392 20:13002406-13002428 AATGGTGTGGAAAAGGAAAAAGG - Intergenic
1172790544 20:37502318-37502340 CATGGAGCTTACAAGGATGAGGG + Intronic
1173520732 20:43698462-43698484 AATGGTGTGAACCCGGAAGATGG - Intronic
1174082556 20:47980937-47980959 CATGGTGTGTCCGGAGAAGATGG - Intergenic
1174331672 20:49824764-49824786 CACAGTGTGCTCAAGGAAGATGG + Intronic
1175203722 20:57295049-57295071 GAAGCTGTGTGCAAGGAAGACGG - Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1178274629 21:31225945-31225967 AGTGGTCTGTACCAGGAAGAAGG + Exonic
1179040951 21:37801795-37801817 TGTGGTGAGGACAAGGAAGATGG + Intronic
1180589857 22:16928216-16928238 CAGGGAGGGTTCAAGGAAGATGG + Intergenic
1180980071 22:19874217-19874239 CACGGTGTGTTCTGGGAAGAAGG + Intergenic
1182204531 22:28610111-28610133 CATGCTTTGTCCCAGGAAGATGG - Intronic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183602286 22:38846912-38846934 GATGGTGTGTTCTAGGCAGAGGG + Intergenic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1185186858 22:49406437-49406459 CACAGTGTGAACAGGGAAGAGGG + Intergenic
951526005 3:23653617-23653639 CAAGATGTGTAGAAAGAAGAGGG + Intergenic
952191299 3:31026001-31026023 CTTGGTGTGTTTAAGGAATAGGG - Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
953027261 3:39152468-39152490 CAAGATGTGGAGAAGGAAGAGGG + Intronic
953691140 3:45120734-45120756 GTTGGTGTGTTCAAGAAAGAAGG - Intronic
954445583 3:50545089-50545111 CATGTTTTTTAAAAGGAAGAAGG + Intergenic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956316605 3:67944601-67944623 CATAGTCTGTACAAGATAGATGG - Intergenic
956925386 3:73981597-73981619 CATCGTGAGTACATGGCAGATGG - Intergenic
960844175 3:121991794-121991816 CATGGTGTGTGCAAAGGAGCAGG - Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
962082858 3:132158828-132158850 CATGGTGTGTGAAGGGAGGATGG + Intronic
962364860 3:134772178-134772200 CATGGTGCCTCCAAGGGAGAGGG - Intronic
963059296 3:141211958-141211980 CTTGGTGGGTAGAAGCAAGATGG - Intergenic
965379755 3:167973886-167973908 GTTGCTGTGGACAAGGAAGAAGG - Intergenic
966333846 3:178846205-178846227 CATTGTCCGTATAAGGAAGAAGG + Intergenic
967657855 3:192072855-192072877 CAGGGTGTGGACAGGAAAGAAGG + Intergenic
967715074 3:192753293-192753315 CATGGTGTGTGCGAGGGAGAGGG - Intronic
968220947 3:196939701-196939723 TATGGTGTGTGCAGGGAAAAGGG - Intronic
968902693 4:3438890-3438912 CAGGGTGTGTACGGTGAAGACGG + Intronic
969832250 4:9807244-9807266 CATGGTGTGTGCCAGGGACATGG - Intronic
970140174 4:12973633-12973655 CTTGGTGCCTACAAGGAAAAGGG - Intergenic
971239653 4:24876673-24876695 CCTGGTGTGTAAGAGGAAGCTGG - Exonic
974062335 4:57046738-57046760 GAGGGTGGGTACAAGGCAGAGGG - Intronic
975759665 4:77606777-77606799 CAAGGTGTGTACAAGTTAGTAGG - Intronic
978357422 4:107891845-107891867 CATGGTGACAAAAAGGAAGATGG + Intronic
978483587 4:109224184-109224206 CATTGTGTTTAAAAAGAAGAAGG + Intronic
979675350 4:123403274-123403296 CATGGGGTGAAGAAGGAAGGTGG - Exonic
981143614 4:141300135-141300157 TATGGTATGGACAAGGCAGAGGG + Intergenic
982970438 4:161977524-161977546 AATGGCGTGTACATGGAAGGCGG + Intronic
985111153 4:186547160-186547182 GATGGTGTGTCCCAGGAACAGGG - Intronic
985136772 4:186794152-186794174 CATAGTGTGTGCCAGGGAGACGG - Intergenic
985210985 4:187594249-187594271 CATGGTTTGCACAAGGAGGTTGG - Intergenic
986974181 5:13376698-13376720 CATAGTGAGTACAGGAAAGATGG + Intergenic
988019340 5:25603738-25603760 TATGCTGTATACAAGGGAGAGGG + Intergenic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
991189229 5:63849225-63849247 CATGGTGTATAAAATGAAAATGG + Intergenic
992773162 5:80068248-80068270 CATGGAGTGTAATAGGAACAGGG + Intronic
994103418 5:95918994-95919016 CATGGCTTGAACAGGGAAGAAGG + Intronic
994392745 5:99205698-99205720 CAGGGTGTTTACAATGTAGAGGG + Intergenic
997516816 5:134495874-134495896 AATGGTGTGAACCCGGAAGACGG - Intergenic
1000922670 5:167157165-167157187 CATTCTTTGTACAAGGTAGAAGG - Intergenic
1003490532 6:6617347-6617369 GATGGTGTTTAAAATGAAGAGGG + Intronic
1003846554 6:10180243-10180265 CATGGTCTGTGCAAGGCCGAAGG + Intronic
1004324229 6:14659353-14659375 CATGGTTTGACAAAGGAAGAAGG + Intergenic
1005266989 6:24122476-24122498 CAGGGTGTGTAAGAGGAAGATGG - Intergenic
1006071981 6:31505126-31505148 CATGGTGGGGACAAGGGAGGGGG - Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007415221 6:41687700-41687722 CCAGGTGAGAACAAGGAAGAGGG + Intronic
1007534712 6:42576148-42576170 AATGGTGTTTACAAATAAGATGG + Intronic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011173116 6:84528608-84528630 TATGGAGTTTACAAAGAAGAAGG + Intergenic
1012352717 6:98272610-98272632 CATGGTGTGTGGTAGGAATATGG - Intergenic
1014425212 6:121296009-121296031 CCTGGTATGTACCAGGCAGAGGG + Intronic
1016350758 6:143164654-143164676 CATGATGGGTTCAAGGAAAAGGG + Intronic
1023272201 7:38476129-38476151 CATGGTATGTTTATGGAAGAAGG + Intronic
1028949766 7:96621027-96621049 CATAGTGTGTTCATGTAAGATGG - Intronic
1029055528 7:97737059-97737081 CGTGGTATTTACAAAGAAGATGG - Intronic
1030981928 7:116196363-116196385 CAAGATGTGGAGAAGGAAGATGG - Intergenic
1031014621 7:116559707-116559729 CATGGAGTGTACAAGTATGTGGG + Exonic
1034289862 7:149921289-149921311 CATGGTGATTAGAAAGAAGATGG - Intergenic
1034796224 7:154015982-154016004 CATGGAGTGTGCAGGGAAAAGGG - Intronic
1035492713 7:159294285-159294307 CCTGGTGGCTACAAGGAAAAAGG - Intergenic
1035911197 8:3567887-3567909 GATGATGTGTGGAAGGAAGAAGG - Intronic
1036021490 8:4851926-4851948 CAGCCTGTGTACAAGGCAGAGGG - Intronic
1036407071 8:8464717-8464739 AATGGTGTGAACCAGGGAGACGG - Intergenic
1038986757 8:32819935-32819957 AATGGTGTGAACACGGGAGACGG - Intergenic
1042295463 8:67212682-67212704 CCTGCTGTGTGAAAGGAAGATGG + Intronic
1042847880 8:73186469-73186491 CCTTGCGTGTACAAGGAGGAAGG + Intergenic
1042847992 8:73187376-73187398 CCTCGCGTGTACAAGGAGGAAGG - Intergenic
1044387468 8:91606599-91606621 CATGGTGTTTACTCTGAAGAGGG - Intergenic
1045388057 8:101690001-101690023 CAGGGTATGTTCAAGGCAGAGGG + Intronic
1046211485 8:111081710-111081732 CATGGTGTGCCCTAGGGAGAGGG - Intergenic
1047094520 8:121609664-121609686 CATGGGATGTAAAAAGAAGAAGG - Intergenic
1048274131 8:133053089-133053111 CAGGGTGTGTTCCAGGCAGAGGG - Intronic
1048297073 8:133222287-133222309 CATGGGGTGAAGAAGAAAGAGGG + Intronic
1049269080 8:141684593-141684615 CACAGTGGGTACAAGGAAGTTGG + Intergenic
1051779349 9:20672060-20672082 CATAGTGTGTACATGGGATAGGG + Intronic
1051873791 9:21769314-21769336 CATAGTTTGGACTAGGAAGAAGG + Intergenic
1057878217 9:98773803-98773825 CATGGTGTGTTCCAGGCAGCGGG - Intronic
1058098744 9:100893755-100893777 CATGGGTTGTTCAAAGAAGAGGG - Intergenic
1058113540 9:101058076-101058098 CTAGGTGTGTTCAAGGAAGAAGG - Intronic
1058523616 9:105836033-105836055 CCTGGTGTGGAAAAGGCAGATGG + Intergenic
1058645663 9:107129549-107129571 CATTGTGTGAACAAGGAAGTTGG - Intergenic
1060325553 9:122611092-122611114 CGTGGTGTGGACAAGGAGGCAGG - Intergenic
1062100846 9:134727866-134727888 CATGGCGGGTCCCAGGAAGAGGG - Intronic
1062516513 9:136939712-136939734 GATGGTGGTGACAAGGAAGATGG - Intronic
1062659704 9:137623247-137623269 GATGCTGTGTACCAGGCAGAGGG - Intronic
1187411097 X:19051159-19051181 AATGGTGTGAACCAGGAAGGCGG - Intronic
1188542311 X:31264614-31264636 CATGGTTTGTAGAAAGAAGAAGG - Intronic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1197188452 X:123616304-123616326 CACTGTGTGTACAAGGAACTAGG - Intronic
1199590523 X:149463863-149463885 CATGGTGGGAACAAGGAACATGG - Intergenic
1201455765 Y:14165597-14165619 CATGGGGTTTCCAAGGAAGCAGG - Intergenic
1201546663 Y:15172740-15172762 AATGGTGTGAACACGGAAGGCGG - Intergenic
1201707015 Y:16949018-16949040 CTTGGCTTTTACAAGGAAGATGG - Intergenic
1201985482 Y:19960291-19960313 AATGGTGTGAACCTGGAAGACGG + Intergenic